ID: 1077111628

View in Genome Browser
Species Human (GRCh38)
Location 11:864572-864594
Sequence GGAGCACTGTGGGCCCGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 351}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077111617_1077111628 15 Left 1077111617 11:864534-864556 CCCAACTGCAGGGCTGGGGGCTC 0: 1
1: 0
2: 1
3: 40
4: 293
Right 1077111628 11:864572-864594 GGAGCACTGTGGGCCCGGTGTGG 0: 1
1: 0
2: 4
3: 31
4: 351
1077111621_1077111628 -7 Left 1077111621 11:864556-864578 CCATCCTCACTCCCAGGGAGCAC 0: 1
1: 0
2: 1
3: 26
4: 405
Right 1077111628 11:864572-864594 GGAGCACTGTGGGCCCGGTGTGG 0: 1
1: 0
2: 4
3: 31
4: 351
1077111618_1077111628 14 Left 1077111618 11:864535-864557 CCAACTGCAGGGCTGGGGGCTCC 0: 1
1: 1
2: 7
3: 44
4: 379
Right 1077111628 11:864572-864594 GGAGCACTGTGGGCCCGGTGTGG 0: 1
1: 0
2: 4
3: 31
4: 351
1077111609_1077111628 28 Left 1077111609 11:864521-864543 CCTTGGCCGCAGGCCCAACTGCA 0: 1
1: 0
2: 2
3: 15
4: 160
Right 1077111628 11:864572-864594 GGAGCACTGTGGGCCCGGTGTGG 0: 1
1: 0
2: 4
3: 31
4: 351
1077111612_1077111628 22 Left 1077111612 11:864527-864549 CCGCAGGCCCAACTGCAGGGCTG 0: 1
1: 0
2: 6
3: 51
4: 410
Right 1077111628 11:864572-864594 GGAGCACTGTGGGCCCGGTGTGG 0: 1
1: 0
2: 4
3: 31
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077111628 Original CRISPR GGAGCACTGTGGGCCCGGTG TGG Intronic
900116659 1:1032042-1032064 GGAACACTGTCAGCCTGGTGTGG + Intronic
900183405 1:1322276-1322298 GGATCACTGTGGGTCCTGTCGGG - Intronic
900919694 1:5662467-5662489 GGAGCACTGTGACCCCCGTGTGG - Intergenic
901063436 1:6484391-6484413 GGGGCACTGGGGGCACAGTGAGG + Intronic
901150607 1:7098742-7098764 GGGGCACTGATGGCCTGGTGGGG + Intronic
901410368 1:9078827-9078849 TGAGCAGTGTGAGCCCTGTGAGG - Intronic
901425468 1:9179988-9180010 GGAACACTGGGGCCCCAGTGGGG + Intergenic
901518769 1:9767589-9767611 GTTGCTCTGAGGGCCCGGTGTGG - Intronic
901565277 1:10109111-10109133 GGAGCATTGTGCGCCAGATGTGG + Intronic
901681034 1:10912979-10913001 GAATCACTGTTGGCCCGATGTGG - Intergenic
902262590 1:15237958-15237980 GGAGCACTGTTGGCCAGGCGCGG + Intergenic
902694260 1:18129597-18129619 CCAGCACTGTGGGGCTGGTGAGG + Intronic
903619947 1:24690742-24690764 GGCTCACTGTGAGCCGGGTGTGG + Intergenic
903883673 1:26529509-26529531 GGAGAACGGTGGCCCTGGTGTGG + Intergenic
905789601 1:40783254-40783276 CGAGCACTGTGTGCCTGGTGCGG - Intergenic
905926089 1:41751007-41751029 GGTGCACTGGGGGCCGGGTGCGG - Intronic
908036820 1:60063808-60063830 TGAGCACTGTGCTCCTGGTGAGG + Intronic
909561702 1:77015479-77015501 GGTGGACTGTGAGCCCTGTGAGG - Intronic
911401194 1:97377794-97377816 GGAGCCATGAGGGCCCAGTGTGG + Intronic
915168858 1:153963779-153963801 GGAGGACTGAGGGGCCGGAGCGG + Intronic
915707945 1:157864232-157864254 TAAGAACTGTGGGCCTGGTGAGG - Intronic
915724583 1:158008347-158008369 CCAGCACTGTGGACCAGGTGAGG - Intronic
915783085 1:158576125-158576147 AGAGCACTGAAGGCCAGGTGTGG + Intergenic
916263018 1:162861318-162861340 GGAGCACTGTGGGCCCCTCTAGG - Intronic
917704297 1:177616100-177616122 GGGGCACTGTGGGCCAGGCGCGG - Intergenic
918014932 1:180624115-180624137 GCAGCACTGAGGGCCCCTTGTGG - Intergenic
918187917 1:182144095-182144117 GGAGAAGTGGGGGCACGGTGAGG - Intergenic
919987703 1:202687306-202687328 GGAGCACTTAGGGCCAGGTGGGG - Intronic
920002158 1:202807713-202807735 GGAGGACTGTGGGCCCGGCGAGG - Intronic
920389363 1:205589328-205589350 GGAGCACGGTAGGCAGGGTGGGG + Intronic
921862500 1:220054446-220054468 AAATCACTTTGGGCCCGGTGTGG + Intergenic
922618231 1:226975796-226975818 GGTGCACTGTTGCCCAGGTGTGG + Intronic
923556851 1:235007800-235007822 GGAGGAGTGTGAGGCCGGTGTGG + Intergenic
924534949 1:244927594-244927616 AAAGCACTGTGGGCCAGGTGCGG - Intergenic
1062844655 10:695195-695217 GGATCACTGTGGCCTCAGTGTGG - Intergenic
1062954885 10:1533524-1533546 GGAGCACTGTGGGGCTGTTTAGG + Intronic
1065390380 10:25175971-25175993 GAAGACCTGTGGGGCCGGTGCGG - Exonic
1065557528 10:26931511-26931533 GGAGCACTCTGGGCCCCGCACGG - Intergenic
1066705307 10:38171413-38171435 GGATATCTGTGGGCCGGGTGCGG + Intergenic
1067063693 10:43091336-43091358 TGAGCACAGGGGGCCAGGTGCGG + Intronic
1069664205 10:70144208-70144230 TGAGCACTGTGGGCCAGGTTTGG + Intronic
1069829376 10:71273177-71273199 CAAGCACTGTGGGCCGGGCGCGG - Intronic
1069888040 10:71636227-71636249 AGAGCACAGTGGGCCGGGTGCGG + Intronic
1070029354 10:72662114-72662136 AGAGCAGTGTAGGCCAGGTGCGG - Intergenic
1070129849 10:73648366-73648388 GGAGCACTCTGGGCCCGAGGTGG + Exonic
1070550012 10:77483564-77483586 AGAGTACTGAGGGCCCAGTGAGG - Intronic
1071588749 10:86850789-86850811 GGAGAACTTTAGGCCAGGTGTGG - Intronic
1073471152 10:103723164-103723186 GGAACCCTCTGGGCCAGGTGGGG - Intronic
1073478261 10:103768514-103768536 AGAGCACAGAGGGCCTGGTGAGG + Intronic
1073776746 10:106794791-106794813 GAAACAATGAGGGCCCGGTGTGG - Intronic
1074421204 10:113310053-113310075 GGAGCGCTGTGGGCCTGGGTGGG - Intergenic
1075011064 10:118870580-118870602 GGGGCAATGTGGGGCTGGTGAGG - Intergenic
1075469884 10:122680154-122680176 GGAGGACTGTGGGCCTCCTGGGG - Intergenic
1075778526 10:125002900-125002922 GGAGCTCTGTGGGCCCTGCTCGG - Intronic
1076117345 10:127909374-127909396 GGAGCACAGTGGACCCACTGAGG - Intronic
1076649788 10:131979992-131980014 GGGCCACTGTGGGCTCGGCGTGG - Intronic
1076826448 10:132972008-132972030 GGAGCACTGCGGGACCGGGCAGG + Intergenic
1077111628 11:864572-864594 GGAGCACTGTGGGCCCGGTGTGG + Intronic
1077179459 11:1205775-1205797 GACCCACTGAGGGCCCGGTGAGG + Intergenic
1077184029 11:1228537-1228559 GGAGCACAGTGGGCCAGGCTGGG - Intronic
1078132012 11:8620946-8620968 GGAGCTCTGTGGGCCTGGCCTGG + Intronic
1079217161 11:18524080-18524102 AGAAAACTGTGGGCCTGGTGTGG - Intronic
1079284665 11:19117562-19117584 GGACCTCTGTGGGCCTGGGGAGG + Intronic
1081674633 11:44961571-44961593 AGAGCACTGGAGGCCAGGTGCGG - Intergenic
1081943346 11:46964573-46964595 AAAGCACTGTGGGCCAGGCGCGG - Intronic
1083030973 11:59591909-59591931 AGAGTACTGGGGGCCAGGTGTGG - Intronic
1083352521 11:62041029-62041051 GGATCACTTTGGGCCGGGTGTGG + Intergenic
1083617701 11:64034788-64034810 GGAGCACTGGGGCCCTGGTGGGG + Intronic
1083968478 11:66057683-66057705 AGGGCACTGTGGGCTGGGTGCGG + Intronic
1084236110 11:67788772-67788794 GGGGCACTGTTGCCCAGGTGTGG + Intergenic
1084745366 11:71166771-71166793 AAAGAAGTGTGGGCCCGGTGTGG - Intronic
1084864392 11:72043654-72043676 AGACAACTGTGGGCCAGGTGTGG - Intronic
1085051604 11:73382912-73382934 GGAGCTGGGTGGGCCAGGTGTGG + Intronic
1085264064 11:75225974-75225996 GGAGCACTGAGGCCCCGGAAGGG - Intergenic
1086618982 11:88861771-88861793 TTAGAACTGTGGGCCAGGTGTGG - Intronic
1087169990 11:95040800-95040822 TGAGCACGGTGGGCACGATGAGG - Intergenic
1090754605 11:129778940-129778962 GCAGCCATGTGGGCCCTGTGGGG + Intergenic
1091108522 11:132944100-132944122 GGAGCGAAGTGGGCGCGGTGCGG - Intronic
1091665870 12:2418223-2418245 GGAGCACTGTGGGGCAGCAGAGG - Intronic
1091672769 12:2464778-2464800 GGAGCACTGAGGACCATGTGTGG + Intronic
1092371266 12:7918307-7918329 AGATCACTCTGGGCCAGGTGCGG + Intergenic
1092427372 12:8385633-8385655 GCAGCACTTTCGGCCCGGGGGGG + Intergenic
1093863702 12:24199080-24199102 AGAGCACTGTCGGCCTGATGAGG + Intergenic
1094315208 12:29132171-29132193 ATAGCACTGGGGGCCAGGTGTGG + Intergenic
1094611775 12:32001659-32001681 AGAGCTGTGTGGGCCGGGTGCGG - Intergenic
1094838212 12:34332074-34332096 GGAGCACTTTGGGCCAGTGGTGG + Intergenic
1094846644 12:34364295-34364317 GGAGCACTGCGGGCCCACGGAGG - Intergenic
1096138861 12:49225699-49225721 GGAGCACTGTGGGGCCTTGGTGG - Intronic
1096466686 12:51850550-51850572 GGAGCACTGGAGGCCCAGAGAGG + Intergenic
1096775865 12:53963731-53963753 GGGGCTTGGTGGGCCCGGTGTGG + Intergenic
1099288564 12:80746618-80746640 TGAGCACTTGGGGCCAGGTGTGG + Intergenic
1100851505 12:98717156-98717178 AGAGCACAGTAGGCCAGGTGCGG - Intronic
1103327839 12:120133350-120133372 CGAGCACTGTGGGGCCAGTAGGG - Intronic
1104123071 12:125817807-125817829 GGAGATCTGTGGGCTGGGTGCGG - Intergenic
1104718594 12:131032145-131032167 GGAGCCCTGTGTGCCCCTTGCGG - Intronic
1105215034 13:18279231-18279253 GGGGCTCTGTGGGGCTGGTGTGG - Intergenic
1106038070 13:26063342-26063364 GGAACACTGGGGGGCAGGTGGGG + Intergenic
1106308259 13:28532391-28532413 GGTGCACTGGGGGCGCGGGGTGG - Intergenic
1107855705 13:44613665-44613687 GAATCACTGTGGGCCAGGCGTGG + Intergenic
1107868937 13:44729547-44729569 GGAGCACTGTGGGCCAAGGCTGG + Intergenic
1108110642 13:47068219-47068241 GCAGCACTGTGGACCAGTTGAGG + Intergenic
1108323211 13:49306163-49306185 TCACCACTGTGGGCCCAGTGTGG + Intergenic
1113668720 13:112160326-112160348 GGAGGACGGTGGGGCCCGTGTGG + Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114337937 14:21712341-21712363 AGAGCACTCTGGGGGCGGTGTGG + Intergenic
1114531484 14:23399275-23399297 GAGGCACTGTGGGCCTTGTGGGG - Intronic
1117528037 14:56631330-56631352 TGTGCAGTGTGGGCCAGGTGTGG + Intronic
1119728593 14:76937248-76937270 GGAGGACTGGGGGTCAGGTGGGG - Intergenic
1120819996 14:88903228-88903250 GGCTCACTCTGGGCCAGGTGCGG + Intergenic
1121403679 14:93704805-93704827 GGAGACCTGTGGGCCAGGTAAGG + Intronic
1122264529 14:100540445-100540467 GGAGCCCGGTGGTCCCGGGGCGG + Intronic
1122757940 14:103997460-103997482 GGAGCAGGGTGGGGCAGGTGAGG + Intronic
1123101123 14:105801820-105801842 AAAGCATTCTGGGCCCGGTGGGG + Intergenic
1123776059 15:23581525-23581547 GGAGCACTGAGAGCCAGCTGTGG - Intronic
1124000975 15:25759513-25759535 AGAAAACTGTGGGCCAGGTGTGG + Intronic
1124291635 15:28457220-28457242 GCAGCACTTGGGGCCAGGTGAGG - Intergenic
1125156242 15:36589792-36589814 GGAGAACTGTTGGCCGGGAGCGG - Intronic
1125603482 15:40927833-40927855 GGAGGACTGGGGGACGGGTGTGG - Intergenic
1127216078 15:56824265-56824287 GCAGCACTGTGGGCTCACTGGGG + Intronic
1128661302 15:69502933-69502955 GGCGCTGTGTGGGCCGGGTGTGG + Intergenic
1129020123 15:72509278-72509300 AGAACAATGTGGGCCAGGTGTGG - Intronic
1131551217 15:93358692-93358714 GGGACACTGTGAGCCGGGTGAGG + Intergenic
1132639979 16:973513-973535 GGAGCTCTGTGGTCCAGGTCTGG + Intronic
1132838145 16:1964954-1964976 AGAGCACTCAGAGCCCGGTGAGG - Intergenic
1133688575 16:8190454-8190476 GGAGCACTCCTGGCCAGGTGTGG - Intergenic
1134457160 16:14403209-14403231 GGACCACTGTGGGCCAGGTGTGG + Intergenic
1134833437 16:17342356-17342378 GGAGGACTGTGGGCTAGGTAAGG - Intronic
1135424160 16:22324094-22324116 GGAGCGCTGTGGTCTAGGTGGGG + Intronic
1135554656 16:23425921-23425943 AGAGGACTATGGGCCAGGTGTGG + Intronic
1135886702 16:26316642-26316664 ACAGCAATGTGGGCCCAGTGTGG + Intergenic
1135887953 16:26329489-26329511 GGAGCAGTGTGGGCCATGGGTGG + Intergenic
1136091191 16:27921265-27921287 GGAGGACTGGGGGTGCGGTGGGG - Intronic
1136894182 16:33987266-33987288 GGAGCACTGTGCTGCGGGTGGGG + Intergenic
1137668008 16:50262914-50262936 GGAGCACTGTGTGCCAGGGCTGG + Intronic
1137787451 16:51150766-51150788 GGAGCGCTAGGGGCCCCGTGCGG + Intronic
1139765337 16:69223918-69223940 GAAGAACTGTCGGCCGGGTGTGG - Intronic
1141504990 16:84471027-84471049 AAAGCACTGTTGGCCGGGTGTGG + Intergenic
1141554478 16:84827855-84827877 AGGGCACTGTAGGCCCGGTGCGG - Intronic
1141607557 16:85163442-85163464 GGGGCACAGTGGGCGGGGTGGGG - Intergenic
1141688369 16:85582947-85582969 GGATTACTGTGGGCACGGGGAGG + Intergenic
1142145494 16:88491276-88491298 GGAGCTCTGCGGGCCCGAGGGGG - Intronic
1144261559 17:13526941-13526963 CCACCACTGTGGGCCGGGTGCGG - Intronic
1144641464 17:16939624-16939646 GCAGGACTGTGGTCCTGGTGTGG + Exonic
1144887514 17:18473458-18473480 CAAGCACTGTAGGCCGGGTGCGG - Intergenic
1144957666 17:19027303-19027325 GGGGCCCTGTGAGCCGGGTGAGG + Intronic
1144977490 17:19147213-19147235 GGGGCCCTGTGAGCCGGGTGAGG - Intronic
1144996666 17:19274302-19274324 GGAACACTGTGGGAAAGGTGGGG + Intronic
1145071704 17:19815348-19815370 GGAGCACTGGGGTCCCTGGGAGG - Intronic
1145144703 17:20470837-20470859 CAAGCACTGTAGGCCGGGTGCGG + Intergenic
1145687533 17:26689046-26689068 GGAGCACTTTGAGGCCTGTGTGG + Intergenic
1146074920 17:29719354-29719376 AGAGGAGTTTGGGCCCGGTGTGG + Intronic
1146330381 17:31922045-31922067 GGTGGAATGTGGGCCGGGTGCGG - Intergenic
1146676067 17:34774677-34774699 GGAGCTCTGTGGGCCTGGGCCGG - Intergenic
1146837571 17:36124935-36124957 GGAGCACTGTCAGCCAGGGGAGG - Intergenic
1147006019 17:37404866-37404888 GGATCACTGTGGGCTGGGAGCGG - Intronic
1147456559 17:40541823-40541845 AGGGCACTGTGGGCGAGGTGAGG - Intergenic
1147546670 17:41407302-41407324 GGAGCTCTGGAGGCCAGGTGGGG - Intergenic
1148006233 17:44432478-44432500 GCAGCTCTGAGGGCCCAGTGAGG + Intronic
1148319734 17:46740266-46740288 GGAGCAATGTGGGCTCTGTAGGG + Intronic
1149701608 17:58659985-58660007 AGAGCACTGAGGGCCAGGCGCGG - Intronic
1150331178 17:64295622-64295644 GTAACAGTATGGGCCCGGTGTGG + Intergenic
1151301696 17:73231948-73231970 GGTGCACTGCGGGCCGGGGGAGG - Intronic
1151830228 17:76545041-76545063 GGTGCCATGTGGGCCGGGTGGGG + Intronic
1152640092 17:81445695-81445717 GGAGCACAGTGGGCCGGGCCAGG - Intronic
1152687770 17:81703066-81703088 GCGGCACTGGGGGCCCGGAGCGG + Intronic
1152750554 17:82060629-82060651 GCAGCACTGTGGGCACAGGGTGG + Intronic
1152789493 17:82271358-82271380 GGAGTATTTTGGGCCGGGTGTGG - Intronic
1152790204 17:82274595-82274617 GCACCACTGTGGGGCCTGTGGGG - Intergenic
1152868540 17:82738187-82738209 GGAGCACTGAGGGCGTGGGGAGG - Intronic
1154311722 18:13272182-13272204 TCAGCACTGAGGGCCAGGTGTGG - Intronic
1157623010 18:49026915-49026937 GGGACACTGTGGGCCCAGGGAGG + Intergenic
1160319811 18:77879885-77879907 TGAGCACCGTGGCCACGGTGTGG - Intergenic
1160936693 19:1599518-1599540 GGGGCGCTGTGGGCGCCGTGGGG - Exonic
1161013305 19:1970441-1970463 GGAGCCAGGTGGGCCAGGTGCGG - Intronic
1162488662 19:10978009-10978031 GGACCACTGTAGTCCCTGTGTGG + Intronic
1162922600 19:13912440-13912462 TGAGCACTGAGGGCGGGGTGGGG + Intronic
1166046095 19:40232064-40232086 GCAGCACTGAGGGCCTGGAGTGG + Exonic
1167369633 19:49072757-49072779 GGGGCACTGTGACCCCGGCGGGG + Exonic
1167605735 19:50480564-50480586 GGAGCACTGTGGGGGGAGTGGGG - Exonic
1167632651 19:50635196-50635218 GGAGCACTCTGGGCCAGGTGTGG - Intronic
925333576 2:3077039-3077061 GCAGCACTCTGGCCCTGGTGCGG - Intergenic
925734021 2:6944479-6944501 GGGGCACTGTGGCCCAGATGTGG + Intronic
926185940 2:10690643-10690665 GAAGTACTGTAGGCCGGGTGCGG + Intergenic
926335763 2:11861509-11861531 AGCCCACTGTGGGCCAGGTGTGG - Intergenic
926680187 2:15657265-15657287 GGAGCAATCTGGGCCCTGAGAGG - Intergenic
926766644 2:16328083-16328105 AAAGCTCTGTGGGCCGGGTGCGG - Intergenic
927678571 2:25124764-25124786 GGAGCAGTAAGGGCCAGGTGTGG + Intronic
928047674 2:27953580-27953602 AGAGAAGTGTGGGCCCAGTGCGG - Intronic
928243633 2:29608170-29608192 GGAGCACTGGGAGGCAGGTGTGG - Intronic
931476156 2:62589807-62589829 AGAGCACTGAGGACCCGGGGTGG - Intergenic
932327544 2:70873060-70873082 GGACCACTGTGGGCTTGGGGAGG - Intergenic
934299286 2:91767506-91767528 GGGGCTCTGTGGGGCTGGTGTGG + Intergenic
938184016 2:129211897-129211919 GGAGCACTGTGGGCAGGTTAGGG + Intergenic
942116578 2:172735212-172735234 GGAGGCCGGTGGGCCCGATGTGG - Intergenic
942285651 2:174413160-174413182 AGAGCACTATCGGCCGGGTGTGG - Intronic
942884048 2:180900422-180900444 GTAGCATTCTGGGCCAGGTGCGG - Intergenic
946276896 2:218638410-218638432 GGTGCACTGTGGGGGTGGTGGGG + Exonic
947273720 2:228368264-228368286 TGAGCACTTGGGGCCGGGTGCGG - Intergenic
947527938 2:230890811-230890833 GGAGCCCTGTGGACTGGGTGGGG - Intergenic
948178331 2:235961201-235961223 GGAGCACAGGGGGCCGGGAGGGG + Intronic
948216347 2:236236389-236236411 GGAGAACCGTGGGCACCGTGAGG + Intronic
948550993 2:238772945-238772967 GGAACAGTGTGGTCCCGGAGGGG - Intergenic
1168811133 20:705354-705376 GGGGCACAGTGGGCCAGGTGTGG - Intergenic
1169394998 20:5221354-5221376 CAAGAACTGTGGGCCCTGTGTGG + Intergenic
1171322396 20:24257985-24258007 GGAGGACAGTGGACCCTGTGAGG + Intergenic
1171446354 20:25207250-25207272 GCAGCCCCGGGGGCCCGGTGGGG + Exonic
1172501435 20:35430820-35430842 AGAACACTGAGGGCCAGGTGCGG + Intergenic
1174929063 20:54793778-54793800 GCTGCACTGTGGGCCCAGGGGGG + Intergenic
1175107051 20:56622933-56622955 GTAACACAGTGGGCCGGGTGCGG - Intergenic
1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG + Intergenic
1175728178 20:61333646-61333668 GCAGCTCTGTGGGCCACGTGTGG - Intronic
1176903238 21:14468924-14468946 GGAGAACTGGAGGCCCGGTAAGG + Intergenic
1178930560 21:36814933-36814955 GGAGGAGTGGGGGCCCTGTGAGG + Intronic
1179553764 21:42159816-42159838 GGGGCACTGGGGGCCATGTGGGG + Intergenic
1179802299 21:43816688-43816710 GCAGCTCTGTGGGGCTGGTGGGG + Intergenic
1179946181 21:44678383-44678405 GGAGCAGTGTGGGTGGGGTGAGG - Intronic
1180782737 22:18529885-18529907 GGGGCACTGTGGGGCCGGGCTGG + Intronic
1181126296 22:20703912-20703934 GGGGCACTGTGGGGCCGGGCCGG + Intergenic
1181239627 22:21469223-21469245 GGGGCACTGTGGGGCCGGGATGG + Intergenic
1181342953 22:22197650-22197672 AGAACACTGTGGGCCAGGCGCGG + Intergenic
1181363788 22:22358251-22358273 GGAGCACTGTGGGACCACTCAGG - Intergenic
1181366600 22:22381336-22381358 GGAGCACTGTGGGACCATTCAGG - Intergenic
1181372961 22:22432454-22432476 GGAGCACTGTGGGACCATTCAGG - Intergenic
1182110254 22:27718101-27718123 GGAGCACTCTGGCCAAGGTGTGG + Intergenic
1182558216 22:31140446-31140468 GGAGCCCAGCAGGCCCGGTGCGG + Exonic
1183718271 22:39547024-39547046 GAAGAACTGTGGGCCAGGTTAGG + Intergenic
1183987404 22:41577104-41577126 GGAACACTCTGGGCCCTGGGAGG + Exonic
1184147022 22:42617721-42617743 GGAGCACAGTGAGGCCAGTGTGG - Intergenic
1184259435 22:43306117-43306139 GGAGCACCCTGGGCCCTGGGTGG - Intronic
1185365860 22:50436436-50436458 GGAACACTGTGGACCTGGTGAGG + Exonic
950110322 3:10414543-10414565 GGGGGAATGTGGGCCCAGTGTGG + Intronic
952001579 3:28791842-28791864 AGAGCAGTGAGGGCACGGTGGGG - Intergenic
953796299 3:45988545-45988567 GGCACACTGGGGGCCCTGTGAGG - Intronic
954061385 3:48070708-48070730 AGGGAACTGTGGGCCAGGTGTGG + Intronic
954579494 3:51695585-51695607 GAGGCACTGTGGGTCCCGTGGGG + Intronic
954784614 3:53083711-53083733 GGAGCTCTGGCTGCCCGGTGGGG - Intronic
955346952 3:58168365-58168387 GGAGCACTGAGGCCGTGGTGAGG - Intronic
955773176 3:62406331-62406353 TAAGCACTGTGAGCCCCGTGAGG - Intronic
955791883 3:62596486-62596508 ATAGCACTCTGGGCCAGGTGTGG - Intronic
958903221 3:99912666-99912688 GAAGCTCTGTGGGCCAGGTGCGG - Intronic
959669129 3:108955020-108955042 AGAGAACTGTAGGCCAGGTGTGG - Intergenic
959866006 3:111270839-111270861 AGAACACTGTTGGCCAGGTGCGG - Intronic
960042149 3:113161641-113161663 GGAGGACTCTGGGCCCCATGAGG - Intergenic
960540887 3:118861346-118861368 GGTGGACTGGGGGCCAGGTGGGG - Intergenic
961569151 3:127785853-127785875 GGAGCACTGTGAGCACCATGAGG + Intronic
962271323 3:133979961-133979983 GGAGCACTGTGGTGCTGTTGGGG - Intronic
962976861 3:140453179-140453201 GGAGCCCTGTGGTCCCTATGAGG - Intronic
963824327 3:149934906-149934928 GGGGAACTTTGGGCCAGGTGTGG - Intronic
964356739 3:155857936-155857958 GGGACACTGAGGGCCTGGTGGGG - Intergenic
966033501 3:175379693-175379715 TGTGGACTGTGGGCCAGGTGTGG - Intronic
966908710 3:184545735-184545757 AGAACACTGTGGGCCAGGTGCGG - Intronic
968045814 3:195623510-195623532 GCAGCACACAGGGCCCGGTGAGG - Intergenic
968308842 3:197666577-197666599 GCAGCACACAGGGCCCGGTGAGG + Intergenic
968503618 4:962120-962142 GGAGCTCAGGGGGCCTGGTGAGG - Intronic
969437917 4:7199285-7199307 GGAGCGAAGTGGGGCCGGTGTGG + Intronic
969595709 4:8148314-8148336 GCAGCACTGTGGGCCTGCGGAGG + Intronic
972583506 4:40416025-40416047 AGATCACTGTGGCCCCAGTGTGG + Intergenic
973334105 4:48938574-48938596 GGACCACTGTGGCCCAGGTCAGG - Intergenic
974906473 4:68064475-68064497 GGAGCAGTGGTGGCCGGGTGTGG - Intronic
975622051 4:76306162-76306184 GGAGGACGGCGGGCGCGGTGCGG - Intronic
978576574 4:110196309-110196331 GGAGGACTGTGGGCCCGAACAGG + Intronic
979667459 4:123327951-123327973 GCAGCACTAAGGGCCCGCTGAGG + Intergenic
983084854 4:163430153-163430175 GGACCACTGTGGGTCAGGTCTGG + Intergenic
983226725 4:165092410-165092432 ACAGCACTGTGGGCCGGGTGCGG - Intronic
983265195 4:165500927-165500949 TGAGCACTGTTGGCCGGGTGCGG + Intergenic
983509084 4:168588189-168588211 GGATCACTGTGAGCCCTGGGAGG + Intronic
985562076 5:593139-593161 GATGCACTGTGGGCCATGTGCGG + Intergenic
985641075 5:1063756-1063778 GGAGGGCTGTGGGCCTCGTGAGG - Intronic
985667124 5:1187079-1187101 GGAGCCCTGTGGCCCCGCTGGGG + Intergenic
986471577 5:8081591-8081613 GGAGCACAGGGGGCCCCCTGGGG + Intergenic
989106799 5:37870551-37870573 GGATCACTGTGGACCTGCTGGGG - Intergenic
989864354 5:46429201-46429223 GGAGCACTTTGGGGCCTATGGGG - Intergenic
992232716 5:74679508-74679530 GGAGGACTGTTGGCCAGGCGCGG + Intronic
997201675 5:132013470-132013492 GGAGCACTCCGGGCCCTATGCGG + Intergenic
997301634 5:132810514-132810536 GTGGGACTGTGGGCCGGGTGTGG - Intergenic
999203674 5:149833482-149833504 AGAGCTCTGTGTGCCCCGTGCGG + Exonic
1000350818 5:160351038-160351060 TTAGCACTGTGGGCCAGGTGTGG - Intronic
1001917464 5:175573871-175573893 GGAGCACTGTGGGTGCTGTGGGG - Intergenic
1002278214 5:178116405-178116427 GGGGCACAGTGGGGACGGTGGGG + Intronic
1002614732 5:180444154-180444176 AGAACACTGTCGGCCAGGTGTGG - Intergenic
1003136721 6:3439918-3439940 GGAGCTCTGGGGTCCCTGTGGGG + Intronic
1003657006 6:8021306-8021328 CGAGTTCTGTGGGCCGGGTGCGG + Intronic
1004907458 6:20249993-20250015 GGAGCACTGAGGTCCTGGTTGGG - Intergenic
1005424139 6:25683438-25683460 GGAGCCCTGTGTGCCCTGGGAGG + Intronic
1005915282 6:30345604-30345626 GGAGCATTGGGGGCGCGGAGGGG + Intronic
1005972449 6:30771995-30772017 AGAGGACTCTGGGCCAGGTGCGG - Intergenic
1006002413 6:30975625-30975647 AAAACACTGTGGGCCAGGTGCGG - Intergenic
1007414432 6:41683624-41683646 GGGGCACCCTGGGCCCGGGGTGG - Intergenic
1010142662 6:72628901-72628923 AGATCACTTTGGGCCAGGTGTGG - Intronic
1011807218 6:91085941-91085963 AGGGCACTGTGGGCCAGGCGCGG + Intergenic
1013995545 6:116303843-116303865 GAAACAGTGGGGGCCCGGTGCGG + Intronic
1014286478 6:119504439-119504461 GGAACACTGGGTGCCCTGTGGGG - Intergenic
1014957380 6:127637649-127637671 GGAGCAGTGTGGGAATGGTGGGG + Intergenic
1015116585 6:129656351-129656373 GTAGCACAGTAGGCCAGGTGCGG + Intronic
1017125269 6:151058964-151058986 GAAGCTCTGTGGGCCAGGTGCGG - Intronic
1017385340 6:153876347-153876369 GGAGTACTATGGGCCAGGCGTGG + Intergenic
1017814796 6:158009037-158009059 GGAGCACTGTAGGCCCAGAAGGG - Intronic
1018340572 6:162846979-162847001 GGAGCACAGTGGGCAGTGTGGGG - Intronic
1018340590 6:162847076-162847098 GGAGCACAGTGGGCAGTGTGGGG - Intronic
1019854727 7:3593307-3593329 GGAGCACTGGGGACAAGGTGGGG + Intronic
1020319140 7:6927269-6927291 GGGGCACTGTTGCCCAGGTGTGG + Intergenic
1020736102 7:11950659-11950681 GGAGCCCTGTGGGTTTGGTGTGG - Intergenic
1022336396 7:29425918-29425940 AGTGGACTGTGGGCCGGGTGTGG + Intronic
1022494630 7:30845097-30845119 GGAGCAGTGGGGGCCCAGGGAGG + Intronic
1023864509 7:44232432-44232454 GAAGCACTGGGGGCCACGTGAGG + Intronic
1024047618 7:45595995-45596017 GGAGCACTTGGGGCCCAGTAGGG + Intronic
1024233444 7:47380124-47380146 GGAGCACTGTGCTCCGAGTGGGG + Intronic
1024568802 7:50707403-50707425 GCAGCTCTGTGGAACCGGTGAGG - Intronic
1024761087 7:52597277-52597299 AGAACACTGGGGGCCGGGTGCGG + Intergenic
1025067165 7:55867172-55867194 TGTGCACTGTTGGCCAGGTGTGG - Intergenic
1025216434 7:57060545-57060567 GGAGGGCTGGGGGCCAGGTGGGG - Intergenic
1025819728 7:64950831-64950853 GGAGTGCTGTGGGCCGGGCGCGG + Intergenic
1026595064 7:71727453-71727475 GGAGCCCTGTGTGCCTGGAGAGG + Intergenic
1026776047 7:73231677-73231699 GGGGAACTGTGGGCCCTGGGTGG + Intergenic
1026794801 7:73359361-73359383 GGGGCAGTGTGGGCACTGTGGGG - Intergenic
1027001163 7:74655609-74655631 ATTCCACTGTGGGCCCGGTGCGG + Intergenic
1027016904 7:74785048-74785070 GGGGAACTGTGGGCCCTGGGTGG + Intronic
1027071123 7:75160888-75160910 GGGGAACTGTGGGCCCTGGGTGG - Intergenic
1029131313 7:98333305-98333327 TGAGCACACTGGGCCAGGTGCGG + Intronic
1029441262 7:100587886-100587908 AGTCCACTGTGGGCCGGGTGCGG - Intronic
1030619483 7:111773724-111773746 ACATCACTGTGGGCCAGGTGCGG + Intronic
1031398020 7:121295925-121295947 GAACCACTGTGGGCCAGGTATGG + Exonic
1032457879 7:132087435-132087457 GGAGGAATGTGGGACCTGTGGGG - Intergenic
1032499064 7:132386240-132386262 GGACCACTGTGGGCCAGGACTGG - Intronic
1033209243 7:139448284-139448306 GGAGAAATGTTGGCCAGGTGTGG - Intergenic
1033232347 7:139610341-139610363 GGAGCACTGGGAGACTGGTGTGG + Intronic
1034430967 7:151040988-151041010 GGAGCAGTGAGCCCCCGGTGGGG + Intronic
1034445285 7:151110986-151111008 GGAGGACTGTGGCCCCACTGGGG + Intronic
1034461520 7:151200275-151200297 AGAGCACCGTGGGCACTGTGGGG + Intronic
1034849301 7:154479265-154479287 GGCCCACTCTGGGCCAGGTGTGG + Intronic
1035237216 7:157506340-157506362 GGAGGGCTGAGGGCCCAGTGTGG + Intergenic
1035263024 7:157673822-157673844 GGAGCCCTGGGTGCCGGGTGGGG - Intronic
1035417198 7:158699603-158699625 AGAGCACGGTGGGCCTGGGGAGG - Intronic
1035556195 8:569027-569049 GGTGCACTGTGGGACTGGTGGGG + Intergenic
1035566402 8:644004-644026 GGAGTCCTGTGGGCTTGGTGGGG + Intronic
1036196078 8:6716269-6716291 GGAGTAGTCTGGGCACGGTGTGG + Intronic
1036308203 8:7617042-7617064 GCATCACTGTGGACCAGGTGTGG - Intergenic
1036359060 8:8065043-8065065 GCATCACTGTGGACCAGGTGTGG - Intergenic
1036623754 8:10447194-10447216 GGAAAACTGTGGGACCGATGAGG + Intergenic
1036811197 8:11868342-11868364 GGAGCCCTGCGGGCCCTGGGTGG + Intronic
1036891898 8:12601909-12601931 GCATCACTGTGGACCAGGTGTGG + Intergenic
1036899445 8:12659884-12659906 GCATCACTGTGGACCAGGTGTGG + Intergenic
1037367254 8:18136211-18136233 GGAGCAGTGAGGGCCAGGTGTGG + Intergenic
1037673004 8:21031245-21031267 GTAGAACTGTGGGCCGGGAGTGG + Intergenic
1037753044 8:21695140-21695162 GGAACACTGTGGGCAAGGTGAGG + Intronic
1037862089 8:22412528-22412550 GCAGCACTGAGTGCCTGGTGCGG + Intronic
1037944142 8:22975855-22975877 AGACCACTGGGGGCCAGGTGCGG + Intronic
1038535282 8:28349128-28349150 GCACCACTCTGGGCCCGGGGTGG + Exonic
1039927147 8:41945558-41945580 GAAGTACTGTGGGCCGGGTGTGG - Intronic
1040133417 8:43824697-43824719 GGAGCACTTTGGGGCCAGTGGGG + Intergenic
1041766263 8:61421298-61421320 GCAGCAAAGTGGGCCTGGTGAGG + Intronic
1043418479 8:80075363-80075385 GGAGCACTTTGCACCCGATGTGG - Intronic
1045500359 8:102739938-102739960 GGAAGACTGTGGGCCCGGAGGGG - Intergenic
1049289191 8:141792463-141792485 GGGCCACAGTGGGCCGGGTGTGG + Intergenic
1050129484 9:2396631-2396653 GGAGCACTGGGGGCTAAGTGAGG - Intergenic
1050568102 9:6908525-6908547 GGAGCATGTTGGGCCAGGTGGGG - Intronic
1052520542 9:29542907-29542929 GGAGAACTGAGGGTGCGGTGGGG - Intergenic
1056500602 9:87205023-87205045 GGAGCCCTGTGGGACAGATGGGG - Intergenic
1056774642 9:89501976-89501998 AGAGCTCTGTGGGTCCTGTGGGG - Intergenic
1058123617 9:101166809-101166831 GGAGCACTGTGTGCATAGTGGGG - Intronic
1058696897 9:107566320-107566342 GAAGCACTGGGGGCCGGGCGCGG - Intergenic
1060204532 9:121674774-121674796 AGAACACTGGGTGCCCGGTGAGG - Intronic
1060549117 9:124476859-124476881 GGAGCACTGGGGGCCTGGCGGGG + Intronic
1060597459 9:124856886-124856908 GGAGCAGGATGGGCCCGGGGTGG - Intronic
1060751200 9:126170608-126170630 GGAGCACTGTGGGACAGGCATGG + Intergenic
1061023223 9:128030395-128030417 GGTGCAGTTTGGGCCAGGTGTGG + Intergenic
1061061456 9:128252570-128252592 AGAGCTCTGTGGGCAGGGTGGGG + Intronic
1062091135 9:134679407-134679429 GGGGCACTGTGGGGCTGGTTGGG + Intronic
1062091143 9:134679428-134679450 GGGGCACTGTGGGGCTGGTTGGG + Intronic
1062091157 9:134679471-134679493 GGGGCACTGTGGGGCTGGTTAGG + Intronic
1062091165 9:134679492-134679514 GGGGCACTGTGGGGCTGGTTGGG + Intronic
1062091194 9:134679577-134679599 GGGGCACTGTGGGGCTGGTTGGG + Intronic
1062091247 9:134679746-134679768 GGGGCACTGTGGGGCTGGTTGGG + Intronic
1062094793 9:134697623-134697645 GGGGCACTGAGGGCCAGGTGGGG - Intronic
1062534282 9:137014684-137014706 GGAGAACAGTGAGGCCGGTGAGG - Exonic
1185937350 X:4273774-4273796 AGTGCAATGTGGGCCAGGTGTGG + Intergenic
1187222172 X:17338703-17338725 GGAGCACAGGGGGACAGGTGAGG + Intergenic
1187960883 X:24565098-24565120 GGAGCACTGGGGGCCCAGTGGGG - Intronic
1189458985 X:41221742-41221764 AGAGCACTGTGGCCACAGTGTGG + Intronic
1190816493 X:53934350-53934372 GGATCCCTTTGGGCCGGGTGCGG - Intergenic
1192410748 X:70930537-70930559 TGAGCAGTGTGGGCTTGGTGAGG - Intronic
1195038445 X:100991662-100991684 TTAGCACTGTGGGCCGGGCGCGG - Intergenic
1196108984 X:111926063-111926085 GGAGCACTATGGCCCTGGTTGGG + Intronic
1196466442 X:115976446-115976468 GGAACACTGTGGGATGGGTGTGG + Intergenic
1198100135 X:133415661-133415683 GGAGCGCCGGGCGCCCGGTGCGG - Intergenic
1198558001 X:137816366-137816388 CAAGCCCTGTGGGCCAGGTGCGG - Intergenic
1202109445 Y:21405578-21405600 GGCGGACTGTGGGCCCTGCGGGG + Intergenic