ID: 1077113146

View in Genome Browser
Species Human (GRCh38)
Location 11:870659-870681
Sequence AATACAGGGTTCACACGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077113146_1077113151 -8 Left 1077113146 11:870659-870681 CCAGGCCGTGTGAACCCTGTATT 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1077113151 11:870674-870696 CCTGTATTAGAGGAAACCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 105
1077113146_1077113154 19 Left 1077113146 11:870659-870681 CCAGGCCGTGTGAACCCTGTATT 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1077113154 11:870701-870723 ACATCTTCCAGGAGCTTCCTCGG 0: 1
1: 0
2: 3
3: 26
4: 240
1077113146_1077113153 8 Left 1077113146 11:870659-870681 CCAGGCCGTGTGAACCCTGTATT 0: 1
1: 0
2: 0
3: 0
4: 69
Right 1077113153 11:870690-870712 CCTCAGGAAAAACATCTTCCAGG 0: 1
1: 0
2: 1
3: 23
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077113146 Original CRISPR AATACAGGGTTCACACGGCC TGG (reversed) Intronic