ID: 1077114353

View in Genome Browser
Species Human (GRCh38)
Location 11:876610-876632
Sequence GTCCAAGGAGGACACTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077114353_1077114365 25 Left 1077114353 11:876610-876632 CCTTGCCAGTGTCCTCCTTGGAC 0: 1
1: 0
2: 2
3: 14
4: 243
Right 1077114365 11:876658-876680 TACCCTTGAGGCAGGAGCCATGG 0: 1
1: 0
2: 0
3: 27
4: 233
1077114353_1077114363 17 Left 1077114353 11:876610-876632 CCTTGCCAGTGTCCTCCTTGGAC 0: 1
1: 0
2: 2
3: 14
4: 243
Right 1077114363 11:876650-876672 CCCTGCTGTACCCTTGAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 177
1077114353_1077114360 13 Left 1077114353 11:876610-876632 CCTTGCCAGTGTCCTCCTTGGAC 0: 1
1: 0
2: 2
3: 14
4: 243
Right 1077114360 11:876646-876668 CCCTCCCTGCTGTACCCTTGAGG 0: 1
1: 0
2: 1
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077114353 Original CRISPR GTCCAAGGAGGACACTGGCA AGG (reversed) Intronic
900411897 1:2516301-2516323 GTCCATGAAGGACTATGGCAGGG + Intronic
900680697 1:3914753-3914775 GCCGAGGGAGGACACTGACATGG - Intergenic
901491276 1:9597579-9597601 CTCCATGGAGGGCACAGGCAAGG - Intronic
902694064 1:18128544-18128566 GGCCAAAGGGGACACTGTCATGG - Intronic
904048526 1:27623853-27623875 GGCCAAGGAGGATGCTGGCCTGG - Exonic
904286234 1:29454769-29454791 GTCCAGGGAGCACACTGACAGGG + Intergenic
904370343 1:30044125-30044147 GGCCAGGCAGGACCCTGGCAGGG - Intergenic
904418005 1:30374611-30374633 GGCCAAGAAGGACACTGACGGGG - Intergenic
904481854 1:30798850-30798872 TGCCAAGGAGGAAACTGGCCGGG + Intergenic
904680909 1:32228588-32228610 GTCCAAGGACAACACAGCCAAGG + Exonic
904862022 1:33545693-33545715 GACCAAGACGGACACTGCCATGG - Intronic
906795342 1:48692371-48692393 GTCCAAGTGGGAGGCTGGCATGG - Intronic
907271517 1:53294162-53294184 GTCCAAGGGGCAGACTGGCATGG - Intronic
907816897 1:57927160-57927182 GTACAAGAAGGAAACTGTCATGG - Intronic
908310869 1:62881532-62881554 GTCAAAAGAGGACACTGGCATGG - Intergenic
908483903 1:64571607-64571629 GTGGAAAGATGACACTGGCAAGG - Intronic
911650837 1:100386492-100386514 CTTCAAGGAGAACACTTGCAAGG - Intronic
916520065 1:165555632-165555654 GGCAAAAGAGGACACTGGCTGGG + Intronic
920314169 1:205065881-205065903 GTCCAAGGAGGCCACAGTCCTGG + Exonic
920364386 1:205440378-205440400 GGCCCAGGAGGATGCTGGCAGGG + Intronic
921885000 1:220296631-220296653 GTCCTTGGAGGACTCTTGCAGGG + Intergenic
923797117 1:237168212-237168234 ATCTAAGAAGGACACTGACATGG - Intronic
924746393 1:246837774-246837796 GTCCAGGCAGGACAGTGGGATGG - Intergenic
1063932933 10:11047312-11047334 GTCCCTGGAGGACACTAGGAGGG + Intronic
1066994370 10:42550710-42550732 GTCCATGCATGACTCTGGCATGG + Intergenic
1068885470 10:62092571-62092593 ATCCAAGGAGGTCTCTGGGAAGG + Exonic
1069821124 10:71229435-71229457 GGCGGAGGAGGACACTGTCAAGG - Intronic
1070359127 10:75670579-75670601 CTCCAAGGAGGCCTCTGGGAGGG + Intronic
1070595563 10:77830536-77830558 GTCCTCGGAGGACGCTGACAGGG - Intronic
1073094763 10:100972794-100972816 GTCCAAGGAAGTCACTTGGAAGG - Intronic
1074138147 10:110644968-110644990 GTCCCAAGAGGACGCTGGAATGG + Intronic
1077114353 11:876610-876632 GTCCAAGGAGGACACTGGCAAGG - Intronic
1077474796 11:2781310-2781332 TCCCAAGGAGGACACAGACAGGG + Intronic
1080585067 11:33674461-33674483 GTCCAAGAATGACAGTGGTATGG + Intergenic
1080870863 11:36235934-36235956 TTCCAAGGAGCACACATGCATGG + Intergenic
1084022897 11:66428425-66428447 GCCCCAGGAGGACCCTGGCATGG + Intergenic
1084122616 11:67078179-67078201 GTCCAAGGAGGGCACGGGGGCGG + Intergenic
1084279130 11:68075342-68075364 GTCCAAAGAGCACCCTAGCATGG + Intronic
1084598904 11:70133339-70133361 CTCCATGGAGGATGCTGGCAAGG - Intronic
1085387435 11:76165096-76165118 GCACAGGGAGGACACAGGCACGG + Intergenic
1088095667 11:106098102-106098124 GACCAAGGAGTATTCTGGCAGGG - Exonic
1088097824 11:106120339-106120361 CTCCAAGCATGACACTGCCAGGG + Intergenic
1091015714 11:132049405-132049427 TTCCAGGGAGGAGACTGGCATGG - Intronic
1092139269 12:6171663-6171685 TTCCAAGGAGGCCCCAGGCATGG - Intergenic
1093516434 12:19992265-19992287 GTTCTAGGAGGCAACTGGCATGG - Intergenic
1094264771 12:28544188-28544210 TACCAAGGAGGAGACTGGTAGGG - Intronic
1101348933 12:103910194-103910216 TTCCAAGGATGAGACTGGGAGGG + Intergenic
1103008274 12:117438958-117438980 GGCCAAGGAGGGCCCTGGCCAGG - Intronic
1103211093 12:119166973-119166995 GTACTAGGAGGACTGTGGCAAGG + Intergenic
1104721193 12:131046023-131046045 GACCAGGGAGGACACTGACCAGG - Intronic
1104721213 12:131046106-131046128 GACCAGGGAGGACACTGACCTGG - Intronic
1104721237 12:131046208-131046230 GACCAGGGAGGACACTGACCAGG - Intronic
1104721263 12:131046310-131046332 GACCAGGGAGGACACTGACCAGG - Intronic
1104721272 12:131046344-131046366 GACCAGGGAGGACACTGACCAGG - Intronic
1104721280 12:131046377-131046399 GACCAGGGAGGACACTGACCAGG - Intronic
1104721299 12:131046447-131046469 GACCAGGGAGGACACTGACCAGG - Intronic
1104721308 12:131046481-131046503 GACCAGGGAGGACACTGACCAGG - Intronic
1104721330 12:131046551-131046573 CACCAGGGAGGACACTGGCCAGG - Intronic
1104721340 12:131046585-131046607 GACCAGGGAGGACACTGACCAGG - Intronic
1104721352 12:131046619-131046641 GACCAGGGAGGACACTGCCCAGG - Intronic
1104721361 12:131046653-131046675 GACCAGGGAGGACACTGACCAGG - Intronic
1104721390 12:131046739-131046761 GACCAGGGAGGACACTGCCCAGG - Intronic
1104721399 12:131046773-131046795 GACCAGGGAGGACACTGACCAGG - Intronic
1104721404 12:131046789-131046811 GCCCAGGGAGGACACTGACCAGG - Intronic
1104721417 12:131046839-131046861 GACCAGGGAGGACACTGACCAGG - Intronic
1104721421 12:131046855-131046877 GACCAGGGAGGACACTGACCAGG - Intronic
1104721435 12:131046907-131046929 CACCAGGGAGGACACTGGCCAGG - Intronic
1104721445 12:131046941-131046963 GACCAGGGAGGACACTGACCAGG - Intronic
1106168712 13:27270985-27271007 GTCCGAGGAGGACTCGGGGATGG - Exonic
1106922046 13:34574284-34574306 GTGGAAGGAGAACATTGGCAGGG - Intergenic
1113750011 13:112770513-112770535 GACCAAGGAGGACAGAGGGATGG + Intronic
1113844533 13:113378974-113378996 TTCCAAGCAGGGCACAGGCAGGG + Intergenic
1113844544 13:113379031-113379053 TTCCAAGCAGGGCACGGGCAGGG + Intergenic
1113844554 13:113379088-113379110 TTCCAAGCAGGGCACAGGCAGGG + Intergenic
1116951979 14:50886916-50886938 GGCCAAGGAGGACTCTTTCAAGG - Intronic
1117178332 14:53168032-53168054 GTCTATGAAGGACACTGCCAAGG - Intergenic
1121023673 14:90598664-90598686 CCCCAAGTAGGACACTGGGACGG + Intronic
1123008472 14:105335703-105335725 GGCCAACGAGGACACTGAGAAGG + Intronic
1124237317 15:28002007-28002029 GTTCAAGTAGGTCACTGACACGG + Intronic
1124603154 15:31151378-31151400 CTCCAGGGAGGACTCTGGCCAGG - Intronic
1126536326 15:49769450-49769472 GTCCTAGGAGGAAACTTGGATGG - Intergenic
1127380775 15:58428965-58428987 GACCAGGGAGGCTACTGGCAGGG - Intronic
1128681082 15:69652126-69652148 TTCAAAGAAGGACACTTGCATGG + Intergenic
1129393785 15:75233611-75233633 GGCCACAGAGGACACTGGCTGGG + Intergenic
1131300949 15:91199364-91199386 GTCCCCGGAGCACACTGGCCTGG - Intronic
1132693543 16:1192267-1192289 GTCCAGGTAGGACCCTGGCCTGG + Intronic
1138096575 16:54216694-54216716 ATCCAAAAAGGCCACTGGCATGG - Intergenic
1138304686 16:55963628-55963650 GACCAAGGCTGACACTGGCAGGG - Intergenic
1141640112 16:85335968-85335990 GTCCCAGGAGGACAGAGCCAGGG + Intergenic
1142079968 16:88143791-88143813 GGCCTGGGAGGACACAGGCAGGG - Intergenic
1143306408 17:5950815-5950837 GTCCAGGAAGGACCGTGGCAAGG - Intronic
1143585703 17:7849159-7849181 GGCCAAGGAGGAGGCTGGCGGGG + Exonic
1144019057 17:11223827-11223849 GTCAACCGTGGACACTGGCAGGG + Intergenic
1144432386 17:15205843-15205865 TACCAATGAGGACACAGGCATGG + Intergenic
1144509299 17:15861627-15861649 GTTTAAGGAGGACTTTGGCAGGG + Intergenic
1147191714 17:38741827-38741849 GTCCATCAGGGACACTGGCAGGG - Intronic
1148117310 17:45183896-45183918 GTCCAGGCAGGACAATGGAAAGG - Intergenic
1148579708 17:48735088-48735110 GTGCAAGGTGAACACTGGCAGGG - Intergenic
1149532767 17:57408632-57408654 GGCCCAGGAGGACTCTGGGAAGG - Intronic
1150790458 17:68197631-68197653 CCCCAAGGAGGACACTGCCCCGG - Intergenic
1152064554 17:78103512-78103534 CTCCAAGGAGGAGGCTGCCAAGG + Exonic
1152274637 17:79349157-79349179 CTCCAAGCAGGAAACTTGCATGG - Intronic
1152880011 17:82809186-82809208 CTCCAGGAAGGACACTGGGAAGG - Intronic
1153696282 18:7646187-7646209 GTACAGGCAGGACACAGGCAAGG - Intronic
1153786959 18:8543805-8543827 GTCCAAGGGCGATGCTGGCAGGG + Intergenic
1153919563 18:9776206-9776228 GGCCAAGGAGCCCACTGGAAAGG - Intronic
1156662428 18:39361852-39361874 GTCCAGGTTGGACACAGGCATGG + Intergenic
1158915741 18:62127018-62127040 TCTCAAGGAGGACACTGGGAAGG + Intronic
1160554386 18:79716569-79716591 GGCCAAGGAGGACCCCGGCCTGG - Intronic
1160554411 18:79716664-79716686 GGCCAAGGAGGACCCTGGCCTGG - Intronic
1162301370 19:9846983-9847005 GCCTAGGGAGGACACTGGAAGGG + Intronic
1162414163 19:10524408-10524430 GTGCTGGGAGGACTCTGGCAGGG - Intergenic
1162646357 19:12052988-12053010 TTCCCTGGAGGACAGTGGCAGGG + Intergenic
1162900755 19:13794527-13794549 GTCCTCTGAGGACATTGGCAAGG + Intergenic
1163391158 19:17030808-17030830 AGCCAATGAGGACACTAGCATGG + Intergenic
1166503350 19:43356504-43356526 GTTAAAGGAGGACACTGAGAGGG + Intronic
1166507104 19:43378257-43378279 GTTAAAGGAGGACACTGAGAGGG - Intergenic
925540999 2:4967812-4967834 GTCCAAGGAGTCCTCTGGAAGGG + Intergenic
926984391 2:18606231-18606253 GTGCAAGCAGGACAGTTGCAGGG + Intergenic
927185518 2:20479389-20479411 ATCCCAGCAGGACACTGGCCTGG + Intergenic
927213009 2:20650348-20650370 GCCCAAGGTGGATCCTGGCAAGG - Intronic
927846627 2:26475667-26475689 CGACAAGGAGGACATTGGCAGGG - Intronic
927847341 2:26478342-26478364 TGACAAGGAGGACATTGGCAGGG + Intronic
928066131 2:28166264-28166286 GTCCATGGAGGATGCTGGCTTGG + Intronic
928102788 2:28449259-28449281 GCCCAGGCAGGACACTGGTAAGG + Intergenic
928483699 2:31708537-31708559 GTCTGAGGAGGACACGGACAAGG - Intergenic
930559886 2:52948390-52948412 GTCAAATGAGCACACTTGCAGGG - Intergenic
931462526 2:62461414-62461436 GGCCAAGCAGGACACTAGCAGGG - Intergenic
931744778 2:65282295-65282317 GACAAAGGAGGAAACAGGCAGGG - Intergenic
933812162 2:86039644-86039666 CTCCAGGGAGGAAACTGACAGGG - Intronic
935130478 2:100257559-100257581 CTCCAAGGTGGGCACTGGCCTGG - Intergenic
935595475 2:104874090-104874112 GTTCAAAGAGGATAATGGCAAGG + Intergenic
936578391 2:113674225-113674247 GTTCAAGGACCACACAGGCAGGG + Intergenic
937225484 2:120366449-120366471 GTCCAAGCAGGAGACTGACCAGG + Intergenic
937354846 2:121191867-121191889 GACCAAGCAGGGCACTTGCACGG - Intergenic
937732450 2:125250011-125250033 GTCCATGAAGTACAATGGCAGGG - Intergenic
938058884 2:128236769-128236791 GGCCATGGAGCACAGTGGCAGGG + Intronic
938297960 2:130190208-130190230 ATGCAAGGAGCACACTGCCAAGG - Intronic
938491672 2:131764410-131764432 GCCCAAGGTGGACACTGGACTGG + Intronic
938495896 2:131797932-131797954 GCCCAAGGTGGACACTGGACTGG - Intronic
938636273 2:133230157-133230179 GGTCAAGAAGGACACTGGCCTGG + Intronic
938755048 2:134371793-134371815 GTCCAGGCAGGACTCTGACATGG + Intronic
940246453 2:151623068-151623090 TTCCAAGGGGTAAACTGGCATGG - Intronic
943736187 2:191357667-191357689 GTCAAAGCAGAACATTGGCACGG - Intronic
945967606 2:216205608-216205630 GGCAAAGGAGGACTCTGGAAAGG - Exonic
946137003 2:217655822-217655844 GGGGAAGGATGACACTGGCATGG - Intronic
948035606 2:234855943-234855965 GACCAATGAGGACACTGGTGAGG - Intergenic
949041331 2:241851259-241851281 GTCCACAGAGAACACAGGCACGG + Exonic
1169091173 20:2862228-2862250 GTCCAGGCAGGACACTGGTCTGG + Intronic
1170170513 20:13405849-13405871 GTCTCAGGAGGAAACTGGCTGGG - Intronic
1170716999 20:18840434-18840456 GTGCAAGGAAGCCAATGGCAAGG - Intergenic
1171164208 20:22956346-22956368 GCCCATGGAGGACACTGGCTGGG - Intergenic
1171242925 20:23586168-23586190 GTCCCAGGAGGCCACTGTCTGGG + Intergenic
1172042180 20:32053061-32053083 GTCCAAGGAGGAAAGAGACAGGG - Intronic
1172052029 20:32125169-32125191 AACCAAGGAGGACACTGCAAGGG - Intronic
1172637107 20:36417309-36417331 AACTAAGGAGGAGACTGGCATGG + Intronic
1172785262 20:37464456-37464478 GGCCCGGGAGGACACAGGCAAGG - Intergenic
1173624467 20:44462117-44462139 TTCCATGGAGGACAGTGGCCTGG - Exonic
1174126330 20:48309585-48309607 GTTCCCTGAGGACACTGGCATGG - Intergenic
1176708772 21:10133257-10133279 GCCCAAGGTGGACACTGGACTGG + Intergenic
1177886667 21:26755323-26755345 GTCCAAGGTGGACACTGGAAGGG + Intergenic
1178495718 21:33084493-33084515 GGTGAAGGAGGACAGTGGCATGG + Intergenic
1178730506 21:35097960-35097982 GTCCATGGAGAACAATGTCAAGG + Intronic
1179616146 21:42584505-42584527 GTCCACGGAGGGCAAGGGCAGGG + Intergenic
1180954467 22:19735478-19735500 GGCCCAGGAGGACACTGACAAGG - Intergenic
1182997386 22:34826660-34826682 GTTCAAGTAGGAGAGTGGCATGG + Intergenic
1184309832 22:43633984-43634006 GGGCAAGGAGGAGACGGGCAGGG + Intronic
1184644501 22:45888836-45888858 GTCCATGGCGGACCCGGGCAAGG - Intergenic
1185000028 22:48239715-48239737 GGCCAAGGAGGGGAATGGCAGGG - Intergenic
1185247543 22:49781151-49781173 CTCCTAGGAGGTCACTGGGAAGG - Intronic
1185383159 22:50519394-50519416 GCACAAGGAGGACAGTGGTATGG + Intronic
949513514 3:4786728-4786750 GTGCATGGAGGAAACTTGCAAGG + Intronic
950564873 3:13762744-13762766 GTCAAATGATGTCACTGGCACGG - Intergenic
951780434 3:26356957-26356979 GTCCAAGCAGCACACTTCCATGG + Intergenic
953182960 3:40613617-40613639 GTGGAAGGAGGGCACTGGAAAGG + Intergenic
953545326 3:43860124-43860146 TTCCAAGGGGTACACTGGCATGG - Intergenic
955589558 3:60520672-60520694 GTTCAAAGAGGACACTAACATGG + Intronic
956753037 3:72359974-72359996 GTCCAGGCAGGAGACTGGAAGGG + Intergenic
958836873 3:99156699-99156721 GTCCAAGGAGGTCTTTAGCAGGG + Intergenic
959903314 3:111683985-111684007 TTGCAAGGAGGAGACTGTCAGGG + Intronic
960812220 3:121636098-121636120 GTGTAGGGAGGACAGTGGCATGG + Intronic
961508563 3:127387695-127387717 GTGGAGGGATGACACTGGCAGGG - Intergenic
961631397 3:128301620-128301642 GCCTAAGGAGGACACTGGACAGG - Intronic
962065137 3:131971709-131971731 GTCAATGGGGGACACTGGCAGGG + Intronic
963947421 3:151161481-151161503 GTCCATGGAGGAGACCGGGAAGG + Intronic
966669730 3:182513587-182513609 TCCCAGGGATGACACTGGCAGGG - Intergenic
967973119 3:195013624-195013646 GTCCAGGGAGGACAGAGACAGGG - Intergenic
968659309 4:1792673-1792695 CCCCAAGGAGGACACAGGCCTGG - Intergenic
970234980 4:13949485-13949507 TTCCAAGAAAGACACTGGCTAGG - Intergenic
971248090 4:24948653-24948675 GTGGAAGGAGGACACTGGGCAGG - Intronic
978660820 4:111124064-111124086 CTCCAAGGTGGAAACTTGCAAGG + Intergenic
979425647 4:120561919-120561941 GTGGAAGCAGGACACTGGGAGGG + Intergenic
979513810 4:121584117-121584139 TTGCAAGGAGAACATTGGCAAGG + Intergenic
980570487 4:134610704-134610726 GTCAAATGAGGACACAGGAAAGG - Intergenic
989414705 5:41160246-41160268 GGGCATGGAGCACACTGGCAAGG + Exonic
990601839 5:57366855-57366877 GTCCAAGGGGAACTCTAGCAGGG + Intergenic
990889151 5:60630372-60630394 GTCCAAGGCCGTCACTGGCTTGG - Intronic
991295285 5:65073939-65073961 GTCCAAGAAGCAGAGTGGCATGG + Intergenic
991487704 5:67155326-67155348 GCTGAAGGAGGACACTGTCAGGG - Intronic
995405405 5:111789022-111789044 CTCCAAGTGGGACACTGGCTGGG + Intronic
996282018 5:121741456-121741478 GTCCATGGAGGACATTATCAAGG - Intergenic
998038554 5:138936576-138936598 GTCTGTGGGGGACACTGGCAGGG - Intergenic
999292944 5:150439331-150439353 GTCCAGAGAGGGCACTAGCAAGG - Intergenic
1000763202 5:165252304-165252326 GGTCAAGGAAAACACTGGCAGGG - Intergenic
1002942529 6:1730686-1730708 TTCCAATGAGGACACTGGGGAGG + Intronic
1003116298 6:3285916-3285938 GTCCCAGGAGGACCGTGCCAGGG + Intronic
1006598554 6:35211169-35211191 GTCTGAGGAGAAGACTGGCAGGG - Intergenic
1007577392 6:42934527-42934549 GACCAAGGAGGTGATTGGCACGG + Exonic
1007767472 6:44169525-44169547 GCCCAAGGTGGGCACTGGAAGGG + Exonic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1011337533 6:86277573-86277595 CTCAAAAGAGGACACTGGAAAGG + Intergenic
1015789286 6:136950434-136950456 GTCCCAGGAGGACTGTGGAATGG + Intergenic
1016041482 6:139436361-139436383 GTCCAGGGAGGTCCCTGGGAAGG - Intergenic
1018838125 6:167500370-167500392 GTCAAAGGCAGACACAGGCATGG + Intergenic
1019501652 7:1367845-1367867 GTCCAAGGAGGTCTCTGGGATGG - Intergenic
1024476443 7:49816966-49816988 GTCCCAGGGGGCCAATGGCAGGG - Intronic
1026888156 7:73966716-73966738 GTCCACCCAGGACACTGGCTTGG - Intergenic
1029745369 7:102513165-102513187 GGCCAGGGAGGGCTCTGGCAGGG - Intronic
1032736278 7:134695444-134695466 GTCGACTGAGGCCACTGGCAGGG + Intergenic
1034697979 7:153071425-153071447 GACCAATGAGGAGACTTGCAGGG + Intergenic
1035157133 7:156923450-156923472 GGCCACGGAGCCCACTGGCAAGG + Intergenic
1036068127 8:5407103-5407125 GTCCCAGGAGGGCAGTGCCAGGG - Intergenic
1036653225 8:10659081-10659103 GTCCAAGGACGACAGCAGCAAGG - Intronic
1037121306 8:15290485-15290507 GCCCAAGGAGGGCACTGTCCTGG + Intergenic
1038489932 8:27963548-27963570 CTCCCAGGAGGACACTGGTCAGG + Intronic
1038651901 8:29411733-29411755 GTGCAAGGTGGTCACTGGAAGGG + Intergenic
1041332277 8:56739858-56739880 GGCCACAGAGGGCACTGGCAGGG - Intergenic
1041381456 8:57258115-57258137 GCCCAAGGTGGAGGCTGGCAGGG - Intergenic
1042187858 8:66154693-66154715 GCCCAAGGAGGACACAGGGAAGG - Intronic
1043529721 8:81135847-81135869 GTCAAAGGAAGACCCTGGCCAGG + Intergenic
1044807499 8:96023080-96023102 GTCCAGGGAGCTCACTGGAAAGG - Intergenic
1049582915 8:143420911-143420933 GTCCAGGGAGGTCGCTGGCCCGG - Intronic
1049973388 9:840643-840665 GTGCAGAGAGGACACAGGCATGG + Intergenic
1050730762 9:8706892-8706914 GTCCAGCGGGGACAGTGGCACGG - Intronic
1052792539 9:32889384-32889406 GTCTCAGGAGTACACTGGTAGGG + Intergenic
1053444633 9:38142504-38142526 GTTCAGGGAGGAGACTGGCCAGG + Intergenic
1053645750 9:40118755-40118777 GCCCAAGGTGGACACTGGACTGG + Intergenic
1053759960 9:41344754-41344776 GCCCAAGGTGGACACTGGACTGG - Intergenic
1054326762 9:63716656-63716678 GCCCAAGGTGGACACTGGACTGG + Intergenic
1054538821 9:66257217-66257239 GCCCAAGGTGGACACTGGACTGG - Intergenic
1055776324 9:79770288-79770310 GTACAAGAAGAAAACTGGCAAGG - Intergenic
1057476471 9:95407172-95407194 GACCAGGGAGGACAGAGGCAGGG + Intergenic
1060544930 9:124453990-124454012 CTCCTCGGAGGGCACTGGCAGGG - Exonic
1060998328 9:127887452-127887474 GTCCTGGGAGGGCGCTGGCAAGG + Intronic
1061537244 9:131257803-131257825 CTCCAGGCAGGGCACTGGCAGGG + Intergenic
1062218599 9:135402516-135402538 GCCACAGGAGGAGACTGGCAAGG - Intergenic
1062303272 9:135887776-135887798 GTCAAACAAGGACACGGGCAGGG + Intronic
1062328356 9:136023461-136023483 CTCTAAGGAGGGCACTGGCCAGG - Intronic
1062374202 9:136254665-136254687 GTCCAAGGAGGAGCCACGCAGGG + Intergenic
1062400674 9:136371354-136371376 GTACAAGAAGGTCACAGGCAAGG - Exonic
1202793533 9_KI270719v1_random:102227-102249 GCCCAAGGTGGACACTGGACTGG + Intergenic
1187468929 X:19551391-19551413 GTGCCAGGAGGACCCTGGCCAGG + Intronic
1187936678 X:24342977-24342999 GTCCAAAGAGCACACTGGATAGG - Intergenic
1189295342 X:39913814-39913836 GTCTAAGCCTGACACTGGCATGG + Intergenic
1189342284 X:40213219-40213241 GTACAAGGAGGACAGTGTGATGG + Intergenic
1191257890 X:58287658-58287680 GCCCAAAGAAGAAACTGGCAAGG + Intergenic
1191258993 X:58292443-58292465 GTCCAAGGAAAAAAGTGGCAAGG + Intergenic
1200009067 X:153107911-153107933 GTTCAAGAAGGAGAGTGGCATGG - Intergenic
1200030533 X:153292011-153292033 GTTCAAGAAGGAGAGTGGCATGG + Intergenic
1201149732 Y:11089097-11089119 GCCCAAGGTGGACACTGGACTGG - Intergenic