ID: 1077116861

View in Genome Browser
Species Human (GRCh38)
Location 11:889117-889139
Sequence ACCCCACAGCTGCCAGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 369}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077116853_1077116861 4 Left 1077116853 11:889090-889112 CCTGACCAGGTCCCTCCAGCCAC 0: 1
1: 0
2: 4
3: 46
4: 362
Right 1077116861 11:889117-889139 ACCCCACAGCTGCCAGAGGCCGG 0: 1
1: 0
2: 6
3: 43
4: 369
1077116855_1077116861 -1 Left 1077116855 11:889095-889117 CCAGGTCCCTCCAGCCACGTGGA 0: 1
1: 0
2: 0
3: 21
4: 253
Right 1077116861 11:889117-889139 ACCCCACAGCTGCCAGAGGCCGG 0: 1
1: 0
2: 6
3: 43
4: 369
1077116857_1077116861 -8 Left 1077116857 11:889102-889124 CCTCCAGCCACGTGGACCCCACA 0: 1
1: 1
2: 0
3: 17
4: 215
Right 1077116861 11:889117-889139 ACCCCACAGCTGCCAGAGGCCGG 0: 1
1: 0
2: 6
3: 43
4: 369
1077116852_1077116861 15 Left 1077116852 11:889079-889101 CCAGGCTGGGGCCTGACCAGGTC 0: 1
1: 0
2: 1
3: 30
4: 331
Right 1077116861 11:889117-889139 ACCCCACAGCTGCCAGAGGCCGG 0: 1
1: 0
2: 6
3: 43
4: 369
1077116856_1077116861 -7 Left 1077116856 11:889101-889123 CCCTCCAGCCACGTGGACCCCAC 0: 1
1: 0
2: 1
3: 13
4: 191
Right 1077116861 11:889117-889139 ACCCCACAGCTGCCAGAGGCCGG 0: 1
1: 0
2: 6
3: 43
4: 369
1077116851_1077116861 16 Left 1077116851 11:889078-889100 CCCAGGCTGGGGCCTGACCAGGT 0: 1
1: 0
2: 2
3: 22
4: 366
Right 1077116861 11:889117-889139 ACCCCACAGCTGCCAGAGGCCGG 0: 1
1: 0
2: 6
3: 43
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077116861 Original CRISPR ACCCCACAGCTGCCAGAGGC CGG Intronic
900157976 1:1211177-1211199 ACCCCTCTCCAGCCAGAGGCGGG + Intergenic
900647200 1:3714371-3714393 TCCCCACAGCTGACAAAGCCGGG + Intronic
900927407 1:5714267-5714289 ACCCCACAGCTGTCTGAAGATGG + Intergenic
901924022 1:12554632-12554654 ACGCCTCAGCAGCCAGGGGCGGG - Intergenic
902580041 1:17402437-17402459 CCCCAGCAGCTGGCAGAGGCTGG - Intergenic
902672295 1:17983222-17983244 AGCCCTCAGCTCCCAGGGGCTGG - Intergenic
903117440 1:21189839-21189861 TCCCCACACCTGCCAGAGTAGGG - Intergenic
903211779 1:21822897-21822919 GCCCCACAGCTACCTGAGACGGG - Exonic
903449423 1:23442712-23442734 ACCACACAGCTGGCACAGGAGGG - Intronic
903867590 1:26410605-26410627 ACCCCAGAGGTGTCAGAGACCGG + Intergenic
904036838 1:27563627-27563649 ACCCCAGCACTGCCAGAGCCGGG + Intronic
905034132 1:34906337-34906359 ACCCCACTGTTGCAAGAGCCAGG + Intronic
906511600 1:46413261-46413283 CCTCCACAGCGGCCAGAGTCAGG - Intronic
906696840 1:47828854-47828876 AGCACACAGGTGGCAGAGGCAGG + Intronic
907307712 1:53522555-53522577 ACCCCAGAAGTGCCAGAGCCAGG - Intronic
907666374 1:56436977-56436999 GTCCCCCAGCTGCCAGAGACTGG + Intergenic
908923856 1:69229648-69229670 TCCACACTGCTGCCAGAGTCAGG + Intergenic
910477181 1:87619949-87619971 ACGCCACAGGTGCCAGGCGCAGG + Intergenic
911496385 1:98637093-98637115 ACACCACTGCTGCCAGGGGTGGG - Intergenic
912927993 1:113929983-113930005 TCCCCTCAGCTCCCTGAGGCGGG + Intronic
913533077 1:119746980-119747002 GTCCCAGAGCTGCCAGAGGAAGG + Intergenic
915031388 1:152883102-152883124 ATCCCAAGGATGCCAGAGGCTGG + Intronic
915727224 1:158026275-158026297 AAGCCACACCGGCCAGAGGCTGG - Intronic
916121755 1:161534353-161534375 AACCAACACCTGCCATAGGCTGG + Intergenic
916131348 1:161614299-161614321 AACCAACACCTGCCATAGGCTGG + Intronic
916732501 1:167579296-167579318 TCCCCACAGCTTTCCGAGGCAGG + Intergenic
917034703 1:170735650-170735672 TCCCCACTGCTCCCACAGGCTGG + Intronic
917600248 1:176566518-176566540 AACACACAGCTCCCAGAGGATGG - Intronic
919860210 1:201734938-201734960 ACCCCACAGTTGGGAGGGGCAGG - Intronic
920404166 1:205696700-205696722 ACCTGAGAGGTGCCAGAGGCAGG + Intergenic
920502251 1:206492819-206492841 AGCACACAGCTGGCTGAGGCTGG - Exonic
922095312 1:222438533-222438555 AGCCCACAGCTGTGAGCGGCAGG + Intergenic
922842027 1:228650399-228650421 ACCCCACAGCCGCCCCGGGCTGG - Intergenic
922919744 1:229292498-229292520 ACCCCACAGCCTCCTAAGGCAGG - Intronic
923052516 1:230398732-230398754 ACCCCACAGCTCCCAGAACTGGG + Intronic
924049708 1:240068318-240068340 ACTCCACAGCTTCAAGAGGTAGG + Intronic
924387645 1:243513979-243514001 ACCCCAGAGGTGACAGAGGCTGG + Intronic
924787280 1:247210441-247210463 ACCGCACAGCTGCCAGCGAGGGG + Intergenic
924814037 1:247427086-247427108 ACACCAGATCTGCCAGAGCCTGG - Intronic
1062854679 10:773982-774004 CCCCTGCAGCAGCCAGAGGCTGG - Intergenic
1063455452 10:6179450-6179472 AACCCCCAGCTGCAAGGGGCAGG + Intronic
1064224037 10:13466951-13466973 AACCCAGAGGTGACAGAGGCTGG + Intronic
1064430486 10:15266373-15266395 GCCCCTCGGCTGCCAGGGGCAGG + Intronic
1065201437 10:23316814-23316836 TCCCCACTTCTGCCAGAGTCTGG + Exonic
1068885925 10:62097192-62097214 ACCCAACAGATGGCAGAGTCAGG + Intergenic
1069869669 10:71525600-71525622 AACCCAGAGCTGCCAGCTGCAGG + Intronic
1069947873 10:71999948-71999970 ACCCCACAGCTGTGAGAGGCTGG + Intronic
1069982418 10:72261445-72261467 ACCCCAGAGCTCCCAGGGGGAGG + Intergenic
1070264421 10:74888055-74888077 ACCCCACCTCTGAAAGAGGCAGG - Intronic
1070659250 10:78293133-78293155 ACCCTACAGCAGCCAGCAGCTGG - Intergenic
1070675142 10:78407053-78407075 TCCCGACAGCTCCCAGAAGCAGG + Intergenic
1070925791 10:80220721-80220743 ATCCCACATCTGCCAGAGTAAGG + Intergenic
1072000090 10:91186240-91186262 ACACCACAGCTGTGAGAGTCGGG - Intronic
1072628785 10:97131580-97131602 ACCTCACAGCCTCCAGAGGGTGG - Intronic
1072718144 10:97765172-97765194 GCCCCACAGCTGCCAGCATCTGG + Intergenic
1072810967 10:98461381-98461403 ACCCCATGCCTTCCAGAGGCAGG - Intronic
1073044386 10:100628174-100628196 CCTCCACGGCTGTCAGAGGCGGG - Intergenic
1073131100 10:101189756-101189778 CCCCCAAGGCTGGCAGAGGCTGG + Intergenic
1075021799 10:118957606-118957628 TGCCCACAGCCGCCAGAAGCTGG + Intergenic
1075287377 10:121198788-121198810 AACCCACAGCTGCAAGGGCCTGG - Intergenic
1076061324 10:127416449-127416471 AGCCAACAGCTGCCGGATGCAGG + Intronic
1077115513 11:882900-882922 TCCCCACATCTGCGTGAGGCTGG - Intronic
1077116861 11:889117-889139 ACCCCACAGCTGCCAGAGGCCGG + Intronic
1077154624 11:1085812-1085834 AGCCCTCAGCTGCCAGACGCTGG + Intergenic
1077190397 11:1253655-1253677 TCCCCAAAGCTGGGAGAGGCAGG - Intronic
1077503120 11:2918113-2918135 CCCCAACAGCGGCCAGAGCCTGG + Intronic
1077609830 11:3637346-3637368 ACCCCAGAGCTGACAGGGCCTGG + Intergenic
1078905956 11:15687999-15688021 ATCCCACAGCTGCCAGCCTCAGG + Intergenic
1079110402 11:17602122-17602144 ACCCCACTGCTGCCAAGGGGTGG + Intronic
1083547279 11:63558328-63558350 CTCCCTCAGCTGCCAGAGGCTGG - Intronic
1083896968 11:65624834-65624856 TCCCCTCAACTCCCAGAGGCTGG - Intronic
1083923154 11:65791209-65791231 ACCCAGCACCAGCCAGAGGCAGG - Intronic
1084573754 11:69975655-69975677 GTCCCACAGCTGCCAGTGGAGGG - Intergenic
1085276922 11:75306422-75306444 TCCCCACCTATGCCAGAGGCTGG + Intronic
1086310721 11:85533672-85533694 ATCCCACAGCATCCAGTGGCAGG + Intronic
1087794341 11:102439336-102439358 ACCTCCCAGCTTCCAGAGGAAGG + Intronic
1088135574 11:106552321-106552343 ACCCCTCAGCTGGCAGGGGCAGG - Intergenic
1088570429 11:111218662-111218684 TCCTCACAGCTGCCAGAGCTGGG + Intergenic
1088613566 11:111602198-111602220 GCCTCACCGCTGCCAGGGGCGGG - Intergenic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1090085128 11:123643810-123643832 AGCCCCCAGCTGCAGGAGGCTGG - Intronic
1091619375 12:2074824-2074846 TCCCCACAGGTGCCAGAAGATGG - Intronic
1091809677 12:3385802-3385824 ACACCAAAGCTGCCAGTGGCTGG - Intronic
1092928174 12:13291122-13291144 AGCCCACAGCTGCCAGACCGCGG - Intergenic
1095399896 12:41801974-41801996 ATGCCACAGTCGCCAGAGGCTGG + Intergenic
1095943645 12:47741381-47741403 ACCCAGCAGCAGCCAGAGCCAGG + Intronic
1096154086 12:49332253-49332275 ACCCCTTTTCTGCCAGAGGCAGG + Intergenic
1099433608 12:82618489-82618511 ACACCACTGCTGCCAGGGGATGG - Intergenic
1100514746 12:95316500-95316522 ACCTCACAGGTGCCTGTGGCTGG - Intergenic
1102586048 12:113923720-113923742 ACACCACATCAGCCCGAGGCTGG - Intronic
1103599265 12:122043830-122043852 ATCCCACAGCTGCCAAGGACGGG - Intronic
1103901651 12:124306586-124306608 GCCACACAGCTGGAAGAGGCAGG - Intronic
1103961510 12:124611753-124611775 ACCCCATGCCTCCCAGAGGCAGG - Intergenic
1104079191 12:125415395-125415417 CCCCCACATCTCCCAGAGGAAGG + Intronic
1104287022 12:127432754-127432776 GCCCCACAGAGGGCAGAGGCAGG + Intergenic
1104583895 12:130031513-130031535 ACCCCACAGCAAGCAGAGGTGGG + Intergenic
1104900999 12:132189554-132189576 ACCCCAGAGAAGCCAGAGGACGG - Intergenic
1106792338 13:33168393-33168415 ACTCCACAGCTTCCCCAGGCAGG - Intronic
1107655184 13:42585643-42585665 ACCCCCCGGCTGGCAGAAGCAGG - Intronic
1108004838 13:45935843-45935865 AACCCACAACTGCCACAGTCAGG + Intergenic
1111192658 13:84830770-84830792 ACACCAGGGCTGTCAGAGGCTGG + Intergenic
1113508384 13:110832238-110832260 ACCTCACAGCAGCCAGAGGTGGG + Intergenic
1113652225 13:112042130-112042152 GGACCACTGCTGCCAGAGGCTGG + Intergenic
1113898036 13:113778001-113778023 AGCCCACAGCTGCCTGTGCCAGG + Intronic
1114065331 14:19054805-19054827 GCCCCCCAGCAGCCAGAGGGAGG - Intergenic
1114096931 14:19345197-19345219 GCCCCCCAGCAGCCAGAGGGAGG + Intergenic
1116485563 14:45444319-45444341 CCCCCACAGCTTTCACAGGCTGG - Intergenic
1119703944 14:76772647-76772669 TCCCCGCAGCTGCCTGAGCCTGG - Intronic
1121104821 14:91273143-91273165 ACCCCCCAGCTCCCATAGCCTGG - Exonic
1121329691 14:93042027-93042049 ACCACACAGCTGCCATGTGCAGG + Intronic
1121711776 14:96043898-96043920 AGGCCACACCTGCCAGAGGTGGG + Intronic
1122343741 14:101045381-101045403 GCCCCACCCCTGCCAGAGGCTGG - Intergenic
1122492839 14:102131380-102131402 AGGCCACAGGTGCCAGAGGTAGG - Intronic
1122938908 14:104972541-104972563 ACCTCACAGCAGCCAGAGGGAGG + Intronic
1123491289 15:20784338-20784360 GCCCCCCAGCAGCCAGAGGGCGG + Intergenic
1123540765 15:21287618-21287640 ACCACACAGCTGTCAGACACTGG - Intergenic
1123547791 15:21353429-21353451 GCCCCCCAGCAGCCAGAGGGCGG + Intergenic
1125185524 15:36925257-36925279 AGCCCTCATCTGCCTGAGGCTGG - Intronic
1127572840 15:60261196-60261218 AAGCCACAGCTGGCAGTGGCAGG - Intergenic
1127629715 15:60815595-60815617 CCCCCACTGCAGCCAGAGCCAGG + Intronic
1127849517 15:62900928-62900950 ACCCCACAGCAGTCTGGGGCTGG + Intergenic
1127961523 15:63894293-63894315 ACCCCACAGAGGCCAGAGCCTGG + Intergenic
1128215921 15:65934040-65934062 CCCTCACAGCTGACACAGGCTGG + Intronic
1128309373 15:66620920-66620942 ACCCCACAGCTGCCCTGGGAAGG + Intronic
1128360867 15:66960801-66960823 CCCCCACAGGTGTCTGAGGCAGG - Intergenic
1128741998 15:70090183-70090205 ACCCCAAAGCTGAGCGAGGCAGG + Intronic
1129519590 15:76177392-76177414 ACCCCAAAACTGTGAGAGGCTGG - Intronic
1129689548 15:77705517-77705539 ACCGCCCAGCTGGCAGAGGAGGG + Intronic
1129741374 15:77991246-77991268 AGGCCACCCCTGCCAGAGGCAGG - Intronic
1129756359 15:78101478-78101500 ACCCCAGAGCTCTCAGAGCCTGG + Exonic
1130257519 15:82332638-82332660 AGGCCACCCCTGCCAGAGGCAGG - Intergenic
1130597425 15:85257326-85257348 AGGCCACCCCTGCCAGAGGCAGG + Intergenic
1130910811 15:88269716-88269738 ACCCCAGAGCTGCAGGAGGAAGG - Intergenic
1131046857 15:89322002-89322024 TCCCCACAGCTCCCAGATGGTGG - Exonic
1132344962 15:101102545-101102567 ACCCCATGGCTGCCAGGGGTGGG - Intergenic
1202949077 15_KI270727v1_random:14760-14782 ACCACACAGCTGTCAGACACTGG - Intergenic
1202956121 15_KI270727v1_random:80659-80681 GCCCCCCAGCAGCCAGAGGGCGG + Intergenic
1132515536 16:364163-364185 ACCCCACCCCTTCCAGAGCCAGG - Intergenic
1132615904 16:840975-840997 ACCCCACCCCCCCCAGAGGCCGG + Intergenic
1132746127 16:1437041-1437063 ACCACACAGGTGCCCGAGGGAGG + Intronic
1132756368 16:1487381-1487403 ACCCGATGGCTGCCTGAGGCTGG + Exonic
1132845754 16:2000115-2000137 ACGCCATCCCTGCCAGAGGCAGG - Exonic
1132996831 16:2827863-2827885 CCAGCACAGCTGTCAGAGGCAGG - Intergenic
1133569439 16:7026570-7026592 ACGCCACAGCTGCCAGGAGAGGG - Intronic
1133758699 16:8781295-8781317 ACACCACACCTGAAAGAGGCAGG - Exonic
1134059138 16:11188508-11188530 AGCCCACACCTGCCAAAGACTGG - Intergenic
1134086243 16:11359339-11359361 ACTCCACAGCTCCATGAGGCTGG - Intergenic
1134274068 16:12760016-12760038 AACCCACAGCTGCCATTGGAAGG - Intronic
1134333746 16:13274540-13274562 ACTGCACAGCTGCTAGAGGCTGG - Intergenic
1136109390 16:28055098-28055120 ACCCCTCAGAGGCCAGAGCCAGG - Intronic
1136654314 16:31700795-31700817 ACCCCGGAGCCGCCAGGGGCAGG - Intergenic
1137274963 16:46927371-46927393 AGCACACAGCTGCCAGTGCCTGG + Intronic
1137685253 16:50382289-50382311 ATCAGACAGGTGCCAGAGGCAGG - Intergenic
1138252587 16:55514074-55514096 ACATCACAGCTGCCTGAGACAGG + Intronic
1138351273 16:56347516-56347538 ACCCCACTGCAGCCAGATGAAGG + Exonic
1138627693 16:58265665-58265687 ATCTCACAGCTTCCATAGGCCGG - Intronic
1139958345 16:70703987-70704009 GCACCACACCTGCCAGGGGCTGG + Intronic
1140479849 16:75256699-75256721 AGCTCACAGCCGCCCGAGGCCGG + Intronic
1140645912 16:77029696-77029718 ACTCCATGGCTGCCAGTGGCTGG - Intergenic
1141645471 16:85365080-85365102 ACCCCACAGCTGCCAGTCACTGG - Intergenic
1141700864 16:85641431-85641453 ACCTCACAGCTGCAAAAGGGCGG - Intronic
1141986598 16:87584387-87584409 TACCCACAACAGCCAGAGGCTGG + Intergenic
1142198213 16:88748533-88748555 ACCCCACAGCGGGCAGCGGGAGG + Intronic
1142273474 16:89103397-89103419 CCTCCAGAGCTGCAAGAGGCAGG - Intronic
1142550132 17:732988-733010 TCCCCACATCTGCCTGCGGCTGG + Intronic
1142904716 17:3034133-3034155 ACCCCACAGCAGCCATAATCAGG - Exonic
1143252994 17:5536720-5536742 ACACCACAGCAGCCAGAGTGAGG - Intronic
1145782460 17:27572005-27572027 CCCCAGCAGCTGGCAGAGGCTGG - Intronic
1146275713 17:31514392-31514414 GCCCACCAGCTCCCAGAGGCAGG - Intronic
1146474937 17:33155182-33155204 ACCCCACACCTGGCATTGGCTGG + Intronic
1146907137 17:36624997-36625019 ACCCCAAAGCTGCTTGAGTCAGG + Intergenic
1147631916 17:41937789-41937811 ACCACACTGCTGCCAGTGACAGG + Intronic
1147937579 17:44021849-44021871 ACCTGGAAGCTGCCAGAGGCCGG - Intronic
1149465746 17:56877691-56877713 ACCCCACAGCTGCCCTAGCTGGG + Intergenic
1149598039 17:57875490-57875512 AGCCCACAGCTGCGTGAGCCAGG + Intronic
1151388108 17:73767757-73767779 ACCCCAGTGCTGATAGAGGCTGG - Intergenic
1151764459 17:76125012-76125034 ACACCCCACCTGCCAGAGCCCGG - Intergenic
1151882545 17:76904053-76904075 ACCCCAGAGATGGCAGGGGCAGG - Intronic
1152147980 17:78580693-78580715 ACCCCAGAGCTCCCAGACACAGG + Intergenic
1152261447 17:79269475-79269497 TTCCCACAGCTCTCAGAGGCAGG - Intronic
1152308475 17:79535098-79535120 ACCCCGCAGCTGCCACAGCCTGG - Intergenic
1152347484 17:79762209-79762231 AGGCCAGAGCTTCCAGAGGCTGG - Intergenic
1152409902 17:80117985-80118007 ATCCCACGGCTGCCCGAGGCCGG - Intergenic
1203160305 17_GL000205v2_random:43062-43084 ACCTGGAAGCTGCCAGAGGCTGG - Intergenic
1153784293 18:8520674-8520696 AGCCAACAGCTACCAGAAGCTGG + Intergenic
1154448885 18:14459047-14459069 GCCCCCCAGCAGCCAGAGGGCGG + Intergenic
1155490614 18:26397932-26397954 AACCAGCAGCTTCCAGAGGCTGG - Intergenic
1156407448 18:36796589-36796611 TCCCCATTGCTTCCAGAGGCAGG + Intronic
1156777520 18:40810775-40810797 CCCCCACAGCTGTGAGAGCCTGG + Intergenic
1156811279 18:41255464-41255486 CCCCCACATCAGCCACAGGCAGG + Intergenic
1157484550 18:48077772-48077794 ACCTCTCAGCAGGCAGAGGCAGG + Intronic
1160113599 18:76056852-76056874 TCCCCACAGCTGCTAGAAGGAGG + Intergenic
1160951438 19:1669416-1669438 TCCCTGCAGCTCCCAGAGGCAGG - Intergenic
1161066425 19:2240622-2240644 ACGCCCCAGCGGCCAGTGGCTGG - Intronic
1161315657 19:3616113-3616135 TCCCAGCAGCTGCTAGAGGCTGG + Intronic
1161378930 19:3954313-3954335 AGCCCTCAGCTCCCACAGGCTGG - Intergenic
1161459151 19:4386216-4386238 GCCCCACAGCTGACTCAGGCAGG - Intronic
1161476500 19:4488782-4488804 CCGCCACAGCTGCCAGCGACAGG + Exonic
1161507385 19:4651125-4651147 ACCCCACAGCTCCATGAGGTGGG - Intronic
1161589173 19:5121066-5121088 ACCCCACGGCTGCCCCTGGCAGG - Intronic
1163447156 19:17353432-17353454 TCCTCACAGCAGCCACAGGCAGG + Intronic
1163668642 19:18614625-18614647 CCCCCAGAGCTGCCAGGTGCTGG + Intronic
1163816162 19:19465756-19465778 ACAGCACAGCTGCCAGTGGTGGG - Intronic
1163885409 19:19960744-19960766 ACCCAGAAACTGCCAGAGGCCGG + Intergenic
1163934937 19:20434170-20434192 ACCCAGAAACTGCCAGAGGCTGG + Intergenic
1163968928 19:20773837-20773859 ACCCAGAAACTGCCAGAGGCTGG - Intronic
1165149427 19:33752134-33752156 ACGCCCCAGCTGCCTGAGCCCGG + Intronic
1165480230 19:36058993-36059015 TCTCCACAGCTCTCAGAGGCAGG - Intronic
1166071468 19:40390428-40390450 ACCCCACAGTAGCCACAGACTGG - Intergenic
1166369998 19:42295166-42295188 CCTCCACAGCTGCCACAGGCAGG + Exonic
1166752229 19:45169816-45169838 ACAGCAAAGCTCCCAGAGGCAGG + Intronic
1167088212 19:47324810-47324832 ACCCCACACCTCTCAGAGCCAGG + Intergenic
1167286046 19:48599482-48599504 ACACCAAGGCTTCCAGAGGCCGG + Intergenic
1167358373 19:49017381-49017403 ACCCCACAATTGGCAGAGGCAGG - Intergenic
925046410 2:776289-776311 CCCCCGCAGCTGCCAATGGCCGG - Intergenic
925901299 2:8511155-8511177 TCCCCACAGCTGCAGGGGGCAGG - Intergenic
926116712 2:10218079-10218101 TCCCCACTGCTGCCAGTGCCCGG + Intergenic
927174203 2:20393905-20393927 TCACCACAGCTTCCAGAGGTAGG - Intergenic
928393187 2:30924859-30924881 AAAACACAGCTGTCAGAGGCAGG + Intronic
928603964 2:32927146-32927168 AGCCCACAGCTGTCAGGTGCAGG - Intergenic
929538980 2:42805129-42805151 ACAGCACAGCTGCCAGTGGGCGG - Intergenic
929797177 2:45069070-45069092 ACCACACAGACTCCAGAGGCTGG + Intergenic
930721922 2:54646312-54646334 ACCCCACAGCTGCTTCAGGTCGG - Exonic
932800789 2:74740797-74740819 ACCCCTCTGCTGCCACAGCCTGG - Intergenic
934979444 2:98827837-98827859 TCCCCTCAGCTTCCAGAGACAGG - Intronic
937173654 2:119903616-119903638 TGCCCACAGGTGCCAGTGGCAGG - Intronic
937353475 2:121183661-121183683 CCCCAACTCCTGCCAGAGGCTGG + Intergenic
937901245 2:127020777-127020799 ACCCCACAGCAGCCTCAGGTTGG - Intergenic
938482589 2:131673807-131673829 GCCCCCCAGCAGCCAGAGGGGGG - Intergenic
939981257 2:148784405-148784427 ACTCCACAGTTGCCAGATACAGG + Intronic
941203956 2:162548292-162548314 TCCCTAAGGCTGCCAGAGGCAGG + Intronic
941632029 2:167894969-167894991 ACAACACAGCTGCCTGAGGCAGG - Intergenic
941995978 2:171602445-171602467 ATCCCTCAGCTGCCTGAGGAGGG + Intergenic
942073068 2:172332679-172332701 ACACCAAAGCAGGCAGAGGCTGG - Intergenic
943080528 2:183253934-183253956 CCCCCTCAGCAGCAAGAGGCGGG - Intergenic
947461784 2:230310019-230310041 ACCTCTCAGCTTCCACAGGCGGG - Exonic
947848873 2:233268033-233268055 AAACCACAGCTGCCTGAAGCAGG - Intronic
948085449 2:235243128-235243150 ACCTCACGGCTGTCAGAGCCCGG + Intergenic
948192657 2:236071856-236071878 GCACCACAGCTGCCTGCGGCTGG + Intronic
948284448 2:236772977-236772999 CCCCCACAGCTGGAAGAGACAGG - Intergenic
948398861 2:237668108-237668130 ACCTCAGAGCTGCCTGAGCCGGG + Intronic
1168808777 20:689112-689134 ACCCCGCAGCCTGCAGAGGCCGG - Intergenic
1170147712 20:13195320-13195342 ACCACACAACTTCCAGTGGCAGG + Intergenic
1170787952 20:19483730-19483752 GCCCCACAGTTGCAAGAAGCTGG - Intronic
1172359151 20:34300276-34300298 TCCCCACAGCAGCCAGAAGAGGG + Intronic
1173165645 20:40685291-40685313 ACCCCAAAGCTGATAGAAGCAGG - Intergenic
1173424172 20:42928403-42928425 ATCCCACAGCTCCCAGCTGCAGG - Intronic
1173850248 20:46213234-46213256 CCCCCACTGCTGGCAGAGGCTGG - Intronic
1175828309 20:61948986-61949008 ACCCCAGAGCTTCTGGAGGCTGG - Intergenic
1175878041 20:62239533-62239555 ATCCCAAAGCTGCCGGAGCCAGG - Intronic
1175893221 20:62324439-62324461 ACCACACAGACGCCAGAGCCAGG + Exonic
1176338811 21:5623747-5623769 ACCCAGAAGCTGCCAGAGGCTGG - Intergenic
1176340219 21:5686820-5686842 ACCCAGAAGCTGCCAGAGGCTGG - Intergenic
1176423818 21:6535535-6535557 GCACCACAGCTGCCAGAGGCAGG - Intergenic
1176447332 21:6831478-6831500 GCCCCGCAGCAGCCAGAGGGCGG - Intergenic
1176472473 21:7118973-7118995 ACCCAGAAGCTGCCAGAGGCTGG - Intergenic
1176496034 21:7500751-7500773 ACCCAGAAGCTGCCAGAGGCTGG - Intergenic
1176504608 21:7637636-7637658 ACCCAGAAGCTGCCAGAGGCTGG + Intergenic
1176825500 21:13696504-13696526 GCCCCGCAGCAGCCAGAGGGCGG - Intergenic
1179375574 21:40847193-40847215 GCGCCCCAGCGGCCAGAGGCAGG - Intergenic
1179385083 21:40933905-40933927 ACCGCACAGATGGCAAAGGCTGG + Intergenic
1179699311 21:43143850-43143872 GCACCACAGCTGCCAGAGGCAGG - Intergenic
1179955508 21:44736056-44736078 ACACCACAGCTGCCAGGAGCTGG - Intergenic
1180162773 21:46005738-46005760 GCCCCTCAGGTGCCACAGGCAGG + Intergenic
1180483822 22:15777425-15777447 GCCCCCCAGCAGCCAGAGGGAGG - Intergenic
1181020499 22:20099315-20099337 ACCCTGCAGCTGCCAGAGGCTGG - Intronic
1181629254 22:24141971-24141993 ACCCCATACCTGCCAGAGTTGGG + Intronic
1181943822 22:26499513-26499535 TCCCAACAGCTGCCACAGTCTGG - Exonic
1182447507 22:30398094-30398116 TCCCCACTGCTGCCAGTGGCAGG - Intronic
1182687314 22:32131207-32131229 ACCAAACAGCTGCCTGAGGCCGG + Intergenic
1183163732 22:36132137-36132159 CCTCCCCAGCTGCCAGACGCTGG + Intergenic
1183432849 22:37775991-37776013 ACGGCAGAGCTGCCAGTGGCAGG - Exonic
1183456674 22:37926741-37926763 ATGCCAGAGCTGGCAGAGGCAGG + Intronic
1183472509 22:38017059-38017081 GCCCCACAGCTGCCTCAGGAGGG - Intronic
1183522713 22:38304679-38304701 TCCTCACAGCAGCCAGAGGGTGG + Intronic
1183742023 22:39674119-39674141 TCCTCACATCTGCCAGAGCCAGG + Intronic
1184120320 22:42445772-42445794 ACCCCACAGCTGCCAGGGCTGGG - Intergenic
1184234102 22:43173943-43173965 ACCAGAGAGCTGTCAGAGGCAGG + Intronic
1184491962 22:44814952-44814974 ACCCCACAGGTGCCAAAGGCCGG - Intronic
1184782147 22:46654817-46654839 ACCCCACAGGTTCCGGAGGAGGG - Intronic
1184787703 22:46679899-46679921 GCCCCACGGCTGCCGGCGGCGGG + Intergenic
1184970836 22:48018826-48018848 CCACCTCAGCTGCCAGAGCCTGG - Intergenic
1203239484 22_KI270733v1_random:1278-1300 ACCCAGAAGCTGCCAGAGGCTGG - Intergenic
950578904 3:13850341-13850363 CCGCCCCAGCTGCCAGGGGCTGG + Intronic
950715957 3:14848024-14848046 ACCCCGCGGCTGACAGAGCCCGG - Intronic
950776578 3:15355612-15355634 ACTCCACAGCTGCCTGAGGTGGG - Intergenic
953237931 3:41122281-41122303 AACCCACAGCTTCCAGAAGAAGG - Intergenic
954387706 3:50252961-50252983 ACCCCCACTCTGCCAGAGGCAGG - Intronic
954797008 3:53166711-53166733 GCCCCTCAGGTGCCAGATGCAGG - Intronic
956285756 3:67608296-67608318 AACCCACAGCTGACAGAAGTGGG + Intronic
962526590 3:136243008-136243030 ACACCAGAGCTTCCAGAAGCTGG + Intergenic
962535677 3:136327082-136327104 ACCTCACAGCTGAGAGTGGCAGG + Intronic
966121740 3:176529340-176529362 ACCACACTGCTGCCGGAGGTTGG - Intergenic
967964903 3:194953428-194953450 ACACCAGATGTGCCAGAGGCCGG + Intergenic
968258978 3:197303640-197303662 ACCCCACAGCTGGCTGGAGCTGG + Intergenic
969183050 4:5456527-5456549 AGCCCACAAATGCCAGAGGCAGG - Intronic
969310540 4:6350700-6350722 AACCCAGAGTGGCCAGAGGCTGG + Intronic
969414459 4:7049644-7049666 ATCCCTCTGATGCCAGAGGCTGG - Intronic
969601305 4:8178031-8178053 GCCCCGCAGCAGCCAGTGGCTGG - Intergenic
971473964 4:27055420-27055442 AGCCAACAGCTGCCAGCTGCAGG + Intergenic
976226054 4:82796729-82796751 TCCCCCCTGCTTCCAGAGGCAGG - Intronic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
976651924 4:87444846-87444868 AGCCCACAGGTGGCAGAGTCTGG + Intronic
978062465 4:104354531-104354553 ACCCCACAGATGGCATGGGCTGG + Intergenic
981936220 4:150242686-150242708 TCCCCAAAGCAGCCAGAGACAGG + Intronic
985529347 5:424665-424687 GCCCCACATCTGCCAAGGGCTGG + Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
985842391 5:2317913-2317935 AACCCACAGCAGCCAGGGCCAGG - Intergenic
989150199 5:38291424-38291446 GCCACACAGATGCCAGAGGTTGG - Intronic
992314304 5:75536719-75536741 GCCCCCCAGCTACCAGAGGCAGG + Intronic
994174946 5:96701315-96701337 GCCCCACAGCTTCCAGAGTTAGG - Intronic
994685782 5:102949961-102949983 AGCCCTCAGCTGCCACAGGTGGG + Exonic
997352761 5:133242626-133242648 ACCCCACAGGTTCCACAGGCTGG + Intronic
997602456 5:135149907-135149929 TCCCCAGAGCTGCCTCAGGCAGG - Intronic
998040797 5:138950009-138950031 ACCCCAAAGCTTCCAGAGGCAGG + Intronic
999719284 5:154386631-154386653 ACTCTCCAGCTGCCAAAGGCTGG + Intronic
999754467 5:154653929-154653951 ACCACACAGCAGACAGAGCCAGG + Intergenic
1000148214 5:158473700-158473722 ACCCCTCAGCTGCTAGAATCAGG + Intergenic
1001313505 5:170627406-170627428 ACCCCACACCTGCCAATGCCGGG + Intronic
1002099903 5:176852206-176852228 ACCTCTCACCTGGCAGAGGCAGG - Intronic
1003741076 6:8940556-8940578 ATCCCACGCCTGCCTGAGGCCGG + Intergenic
1005812904 6:29530120-29530142 ACCCCACAGGAGGCACAGGCAGG + Intergenic
1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG + Intronic
1006603108 6:35238875-35238897 GCCCAACAGCTGCGAGAGGAGGG + Intronic
1007805827 6:44445179-44445201 ATCCCTCAGCTCCCAGAGCCAGG + Intronic
1008646587 6:53520580-53520602 CCACCACAGCTGACAGAAGCTGG + Intronic
1008683965 6:53903726-53903748 CCACCACACCTGCCAGAGGCTGG - Intronic
1014101579 6:117517396-117517418 TCCCCACTGCTTCCACAGGCTGG + Intronic
1015755363 6:136600645-136600667 ACCCCAAAGATGACAGAGGAAGG + Intronic
1015768563 6:136745460-136745482 CTGCCACAGCAGCCAGAGGCAGG - Intronic
1016539609 6:145149922-145149944 ACCCTACCACTGGCAGAGGCAGG - Intergenic
1017373090 6:153736002-153736024 ACTCCCCAGCTTCCAGAAGCAGG + Intergenic
1017415299 6:154213973-154213995 AGCCCACAGCTGCCGGAGTGTGG + Intronic
1017817933 6:158028474-158028496 GCCGCCCAGCTGCCTGAGGCTGG - Intronic
1018610942 6:165647297-165647319 CCCCCGGAGCTGCCAGCGGCAGG + Intronic
1019309228 7:352200-352222 ACCCCACAGGTGCCGGAGCCTGG - Intergenic
1020112832 7:5457219-5457241 ACCACACAGCTGCCACAGAATGG - Intronic
1020461548 7:8434317-8434339 TTCCCACAGCTGCCTGAGGATGG - Exonic
1021927291 7:25545832-25545854 AGCCCTCAGCTGCCCAAGGCTGG - Intergenic
1023054766 7:36282772-36282794 ACCCAGCAGCAGCCAGAGCCAGG - Intronic
1023838148 7:44080356-44080378 AGCCCACACCTGTCAGAGGCCGG + Intronic
1024023478 7:45391611-45391633 AGCTCAAAGCGGCCAGAGGCAGG + Intergenic
1026872409 7:73861130-73861152 ACCTCACAGATGCCACAGGGTGG - Intergenic
1027129095 7:75578217-75578239 ACACCACAGCAGCGGGAGGCAGG + Intronic
1028770664 7:94617010-94617032 ACCCAACACCTGCTAGAGGGTGG - Intronic
1029252245 7:99245104-99245126 ACCCCACGGCTGAGACAGGCTGG + Intergenic
1029593097 7:101520263-101520285 ACCCAACACCTGCCTGGGGCAGG + Intronic
1029737962 7:102474962-102474984 GCAGCACAGCTGCCAGCGGCTGG + Intronic
1029891399 7:103933752-103933774 GCCCCAAAGTTTCCAGAGGCTGG + Intronic
1030792190 7:113743407-113743429 CCACCACAGCTCACAGAGGCAGG + Intergenic
1031594761 7:123637293-123637315 AACCCACATCTGCCAGTTGCTGG + Exonic
1032266139 7:130371279-130371301 TCCTCACAGCTCTCAGAGGCAGG + Intergenic
1032288151 7:130559333-130559355 CCACCCCAGCTGCCAGGGGCCGG + Intronic
1034988821 7:155534693-155534715 CCCCCACAGCAGCAAGGGGCTGG + Intergenic
1035044667 7:155955890-155955912 TCCCCACTGCAGCCAGATGCAGG + Intergenic
1035251373 7:157599703-157599725 AGGTCACAGCTGCCAGAGGCCGG - Intronic
1035275751 7:157746957-157746979 AGCCCACAGCTGAGAGACGCAGG - Intronic
1035275802 7:157747244-157747266 ACCCCACAGCTCAGAGACGCAGG - Intronic
1035275810 7:157747285-157747307 ACCCCACAGCTCAGAGACGCAGG - Intronic
1035275868 7:157747572-157747594 ACCCCACAGCTCAGAGACGCAGG - Intronic
1035275876 7:157747613-157747635 ACCCCACAGCTCAGAGACGCAGG - Intronic
1035275889 7:157747695-157747717 AGCCCACAGCTGAGAGACGCAGG - Intronic
1035275945 7:157747982-157748004 ACCCCACAGCTCAGAGACGCAGG - Intronic
1035275961 7:157748064-157748086 AGCCCACAGCTGAGAGACGCAGG - Intronic
1035276242 7:157749581-157749603 ACCCCACAGCTCACAGCCGCAGG - Intronic
1035276281 7:157749786-157749808 ACCCCACAGCTGAGGGACGCAGG - Intronic
1035276307 7:157749909-157749931 ACCCCACAGCTCAGAGATGCAGG - Intronic
1036694743 8:10967264-10967286 ATCCCACAGTTGCCATAGGAGGG - Intronic
1037164783 8:15813409-15813431 ACCCCAGAGATGGCAGAGACAGG - Intergenic
1037914041 8:22761210-22761232 ACCCCACAGTTCCCCGGGGCAGG - Intronic
1038068833 8:23991452-23991474 ACATCACAGTTGCCAGAGACAGG - Intergenic
1039044307 8:33435974-33435996 ATCCAACAGCTGCAGGAGGCAGG + Intronic
1039796302 8:40918420-40918442 ACCCCACAGGTCCCTAAGGCGGG + Intergenic
1040298233 8:46174347-46174369 CCCCCACAGCTGTCCCAGGCAGG + Intergenic
1040418396 8:47217120-47217142 ACCCCAGAGCATCCAGAGGGTGG + Intergenic
1041182090 8:55259537-55259559 ACTCCACAGCTCTGAGAGGCTGG + Intronic
1042294890 8:67207907-67207929 ACCCCACAGCTCACAGTGGCAGG + Intronic
1042577549 8:70237264-70237286 AGCCAACAGCTGGCAGAAGCAGG + Intronic
1044676393 8:94733058-94733080 ACCCCAAAACTTCCAGAGGCAGG - Intronic
1044749613 8:95403350-95403372 AGCTCAGAGCTGACAGAGGCAGG + Intergenic
1045557603 8:103229909-103229931 AGCCCCCAGCTGCCAAAGGTTGG + Exonic
1047447192 8:124930058-124930080 ACACCAAAGCTGCCTTAGGCAGG - Intergenic
1048197406 8:132343489-132343511 TACCCAAAGCTGGCAGAGGCTGG + Intronic
1049618744 8:143588405-143588427 AGCCCACAGCACCCAGAGGGAGG + Intronic
1051576869 9:18626086-18626108 AGCCCAAAGCAGCCAGGGGCAGG - Intronic
1056080457 9:83087791-83087813 AACCCACAGCTAGCAGAGGAAGG - Intergenic
1056307611 9:85305420-85305442 ACTCCACAGATGCCAGGGGTCGG + Intergenic
1056573037 9:87832944-87832966 AGCCCACAGCTGGCAGAGCTGGG + Intergenic
1057495043 9:95553896-95553918 TACCCACAGCTGGGAGAGGCAGG + Intergenic
1059770087 9:117415726-117415748 ACCCCACAACTGACTGAAGCCGG + Intergenic
1060002509 9:119971017-119971039 ATCCCTCAGCTACCAGAGCCTGG - Intergenic
1060114127 9:120927702-120927724 ACACCAGGGCTGCCACAGGCTGG + Exonic
1060476115 9:123988073-123988095 ACACCACAGCTGCCCGGGGCTGG - Intergenic
1060794004 9:126502754-126502776 ACCCCAAACCTGGCTGAGGCTGG - Intronic
1061247817 9:129410113-129410135 ACGCCAAGGCTGCCAGAAGCTGG + Intergenic
1061779347 9:132986645-132986667 ACCCCACACCTGCAAGGGGGAGG - Exonic
1061855764 9:133441244-133441266 CCCCTACAGCAGCCAGAGACAGG + Intronic
1062178145 9:135175772-135175794 TCCCCACAGCCCCCAGAGCCAGG + Intergenic
1062326539 9:136015179-136015201 AGGCCACAGCTGCTGGAGGCTGG + Intronic
1062398843 9:136363631-136363653 GCCCCACAGCCGCCTCAGGCAGG + Exonic
1062452024 9:136619834-136619856 ACCACAGAGCAGTCAGAGGCCGG + Intergenic
1062511176 9:136907037-136907059 AGCCCACTGCTGCCCCAGGCAGG - Intronic
1203422848 Un_GL000195v1:11173-11195 ACCCAGAAGCTGCCAGAGGCTGG + Intergenic
1203521858 Un_GL000213v1:53053-53075 GCCCCGCAGCAGCCAGAGGGCGG + Intergenic
1185980733 X:4774955-4774977 ACCCAGAAGCTGCCAGAGGCCGG - Intergenic
1188195069 X:27222916-27222938 AACCCACATCTGCCAAGGGCGGG - Intergenic
1190303230 X:49068077-49068099 CCCCCATACCTGCCAGAGACAGG - Exonic
1190844274 X:54176946-54176968 CTACCACAGCTGACAGAGGCTGG + Intronic
1191848914 X:65571182-65571204 ACCCCACAGAAGCCAGGAGCTGG + Intergenic
1191993786 X:67068247-67068269 ACAACACTGCTGCCAGTGGCTGG - Intergenic
1192223145 X:69211027-69211049 TCCCCCCAGCTGCCACAGGCTGG + Intergenic
1193517031 X:82478568-82478590 ATACCACAGCTGATAGAGGCTGG + Intergenic
1193917008 X:87378350-87378372 ACTCCACTACTGCCAGAGGATGG - Intergenic
1194070154 X:89313514-89313536 ACCCCAAAGCTGCCAAGGCCAGG + Intergenic
1195211191 X:102653223-102653245 GCCCCACAGCTGACAGAAGGGGG - Exonic
1195217345 X:102714191-102714213 GCCCCACAGCTGACAGAAGGGGG - Exonic
1197392022 X:125878734-125878756 ATGCCACTGCTGCCAGAGGATGG + Intergenic
1199798641 X:151227816-151227838 ACTCCGCAGCTGCCAGAGGAGGG - Intergenic
1200724391 Y:6649140-6649162 ACCCCAAAGCTGCCAAGGCCAGG + Intergenic