ID: 1077119104

View in Genome Browser
Species Human (GRCh38)
Location 11:898681-898703
Sequence GTCCAGTCCAGGCCAGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077119097_1077119104 -1 Left 1077119097 11:898659-898681 CCATTCCTCAGGGCTGTGGTCAG 0: 1
1: 0
2: 1
3: 41
4: 304
Right 1077119104 11:898681-898703 GTCCAGTCCAGGCCAGGTGGGGG 0: 1
1: 0
2: 3
3: 26
4: 264
1077119098_1077119104 -6 Left 1077119098 11:898664-898686 CCTCAGGGCTGTGGTCAGTCCAG 0: 1
1: 0
2: 3
3: 35
4: 273
Right 1077119104 11:898681-898703 GTCCAGTCCAGGCCAGGTGGGGG 0: 1
1: 0
2: 3
3: 26
4: 264
1077119093_1077119104 10 Left 1077119093 11:898648-898670 CCAAGGAAGGGCCATTCCTCAGG 0: 1
1: 0
2: 1
3: 25
4: 180
Right 1077119104 11:898681-898703 GTCCAGTCCAGGCCAGGTGGGGG 0: 1
1: 0
2: 3
3: 26
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077119104 Original CRISPR GTCCAGTCCAGGCCAGGTGG GGG Intronic
900331136 1:2135166-2135188 GGCCACTCCCGTCCAGGTGGTGG - Intronic
900622745 1:3594897-3594919 GGCCAATCCGGGCCGGGTGGCGG - Intronic
901026034 1:6279247-6279269 GACCAGCCCAGGCGACGTGGAGG + Intronic
901039701 1:6356482-6356504 GTCCAGGGCTGGCCAGGTGTGGG - Intronic
901868748 1:12125311-12125333 GCCCAGGCCAGGCCAGGCCGGGG - Intronic
902817850 1:18926329-18926351 GGCCAGGCCAGGCCAGGGGGAGG + Intronic
903101520 1:21034984-21035006 TGCCAGTCCAGGCCCGGTGAGGG + Intronic
903351672 1:22720609-22720631 GTCCAGTCCAGGGATGGCGGTGG + Intronic
903535029 1:24061129-24061151 GGACAGTCCAGCCCAGGTGGAGG + Intronic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
903812933 1:26045146-26045168 TGCAAGTCCAGGCCAGGTCGGGG + Exonic
904410521 1:30322208-30322230 GCCCAGGCCAGGCCAGCTCGGGG - Intergenic
905093484 1:35448674-35448696 GAGCAATCCAGGCCAAGTGGGGG + Intronic
905278889 1:36836413-36836435 GTCCAGCCCATGCCAGGTGTTGG + Intronic
905316540 1:37085179-37085201 GTCTAGGCCAGGCGTGGTGGGGG - Intergenic
905346774 1:37316599-37316621 TTCCAGTCCAGGGCAGGGGCAGG - Intergenic
905876010 1:41432515-41432537 GTACAGGGCAGGCCAGGAGGAGG + Intergenic
905903309 1:41596523-41596545 TTCCTGCCCAGGCCAGGGGGAGG - Intronic
906049013 1:42855362-42855384 GTCCAGTACAGGCCAGGTTAAGG - Intergenic
907274844 1:53311317-53311339 GGCCAGTCCCAGGCAGGTGGCGG + Intronic
910459546 1:87434429-87434451 GTCCAGACCAGGACAGGGGAAGG - Intergenic
911026984 1:93446934-93446956 CACCTGTCCAGGCCAGGTAGGGG + Intergenic
912696975 1:111849104-111849126 GTCTATTCCTGGCCAGGTGCAGG + Intronic
912923399 1:113891593-113891615 CTGCACTCCAGCCCAGGTGGCGG - Intergenic
913259175 1:116982930-116982952 GGCCAGTCCACCCCAGCTGGTGG - Intronic
915472849 1:156136166-156136188 GTCTAGTCAAGGCCAGTTGCCGG - Intronic
915737667 1:158094980-158095002 GTCCGCTCCAGGCCAGAGGGTGG - Exonic
915905393 1:159873211-159873233 GCCCAGGCCAGGAAAGGTGGTGG + Intronic
916827416 1:168455961-168455983 GTCCACACCAGGCCATGGGGAGG - Intergenic
917920280 1:179744404-179744426 ACCCAGGCCAGGCCGGGTGGCGG - Intronic
921638975 1:217528989-217529011 GTTCAGTCCAGACCAGCTAGAGG + Intronic
922724150 1:227914770-227914792 GGGCTGGCCAGGCCAGGTGGAGG - Intergenic
923013333 1:230106360-230106382 ATTCATTCCAGGCCAGGAGGAGG - Intronic
924751960 1:246901779-246901801 GGCCAGTCCAGGCCAGAGTGTGG - Intronic
924763151 1:247007733-247007755 GTCCCGTCCCGCGCAGGTGGGGG - Intronic
1062847958 10:722470-722492 GACCAGTCCAGACCAGATGGAGG - Intergenic
1062848937 10:728686-728708 CTGGAGTCCAGGCCTGGTGGAGG - Intergenic
1063664194 10:8051822-8051844 GTCCGGGCCAGGCCAGGCGCCGG - Intergenic
1064101614 10:12468993-12469015 GTCCTGCCCGGGCAAGGTGGGGG + Intronic
1066010213 10:31188009-31188031 GGCCAGCCCAGGGCAGGAGGGGG - Intergenic
1067017329 10:42768047-42768069 GGCCAGCCCAGGACAGGCGGTGG + Intergenic
1067774456 10:49152913-49152935 GTCCATACCGGGCCAGGTGCAGG - Intergenic
1069745133 10:70710153-70710175 GTGCAGTCCAGGCCTGGGGGAGG + Intronic
1073242199 10:102066091-102066113 GGCCACGCCAGGCCAGGTGGTGG - Exonic
1074535743 10:114327781-114327803 GTCTAGTCTAAGCCAGGTGTTGG - Intronic
1075729046 10:124625537-124625559 GTCCAGGCCTGGCCAGGAGCCGG - Intronic
1076616688 10:131759745-131759767 GTGAGGTCCAGGCCAGGTGTGGG - Intergenic
1077081996 11:728391-728413 GTCCAGGCCTGGCTGGGTGGTGG - Intergenic
1077110705 11:860835-860857 GTCCTGTCCAGTCCAGGGTGGGG + Intronic
1077119104 11:898681-898703 GTCCAGTCCAGGCCAGGTGGGGG + Intronic
1077352132 11:2097868-2097890 GTCCAGGCCAGGGCAGAAGGAGG + Intergenic
1077452176 11:2654844-2654866 GGCAGCTCCAGGCCAGGTGGAGG + Intronic
1078192664 11:9104634-9104656 GTCCACCCCAGGCCAGGAGGGGG - Intronic
1078445923 11:11404815-11404837 TTCAAGTTGAGGCCAGGTGGTGG - Intronic
1079098888 11:17528512-17528534 GGCCAGTGCAGGTCAGCTGGGGG + Intronic
1082635754 11:55591426-55591448 CTGCACTCCAGGCCAGGTGACGG - Intergenic
1083599169 11:63935984-63936006 GTCCAGGCTGGGCAAGGTGGTGG - Intergenic
1083785958 11:64947376-64947398 GTCCAGCCCTGGCCTGCTGGGGG + Exonic
1084362789 11:68679822-68679844 GTCCAGCACACTCCAGGTGGAGG - Intergenic
1084682590 11:70675510-70675532 GTTGATTCCTGGCCAGGTGGGGG + Intronic
1084946073 11:72639269-72639291 GTTCACTCCAGGTCAGATGGAGG - Intronic
1085006669 11:73097928-73097950 GTCTAGTCCTAGCCAGTTGGAGG - Intronic
1088397305 11:109382775-109382797 GTCAAGCCAGGGCCAGGTGGAGG + Intergenic
1088917816 11:114240456-114240478 GTCCAGTCCAGAGTGGGTGGGGG - Intronic
1089126579 11:116180698-116180720 TTCCCCTCCAGGCCAGGGGGAGG - Intergenic
1089299655 11:117490901-117490923 GGCCAGTCCAGGGCAGGCTGGGG + Intronic
1089582780 11:119491924-119491946 TTCCAGTCCAGACCAGCAGGAGG + Intergenic
1090256496 11:125288048-125288070 CTCCGGTGGAGGCCAGGTGGAGG - Intronic
1090744393 11:129694784-129694806 AGCCAGTCCCGGCCAGGAGGTGG + Intergenic
1090903145 11:131050116-131050138 GTACAGTCAAGGTTAGGTGGTGG - Intergenic
1091159380 11:133405895-133405917 GTGCAGTCCAGGCAAGGTAGAGG + Intronic
1091857697 12:3752825-3752847 GGCCAGGCCAGGCCTGGGGGTGG + Intronic
1092689683 12:11094051-11094073 GTCCAGTGCAGGCAAGGCTGAGG + Intronic
1092937262 12:13375609-13375631 GTCTAGAACAGGCCAGGTGGTGG - Intronic
1094502067 12:31030660-31030682 GGCCAGCCCAGCCCAGGAGGAGG + Intergenic
1096102474 12:48978240-48978262 GGCCAGTGCAGGCCCGGAGGCGG + Intergenic
1097147789 12:56953601-56953623 GTCAAGGCCAAGCCTGGTGGGGG - Intronic
1097709016 12:62898027-62898049 GTCCAGCCCAGCCCAGCTTGGGG + Intronic
1098643622 12:72869545-72869567 TTCCAGTCCAGCCCGGGTGATGG - Intergenic
1099873662 12:88378542-88378564 GTCCAGTGCAGGTCATTTGGAGG - Intergenic
1101874963 12:108591808-108591830 GCCCAGTGCAGCCCTGGTGGGGG + Exonic
1101959435 12:109237517-109237539 CTCCAGTCCAGGGCAGGAGGCGG + Intronic
1102256557 12:111418660-111418682 GGCCAGGCCAGGCCGGGCGGGGG - Exonic
1103505526 12:121440398-121440420 GTCCAGCCCAGTCCAGGGGGAGG + Intronic
1104814257 12:131637004-131637026 GTCCTGTCCAGGCCCAGAGGGGG - Intergenic
1105424831 13:20285190-20285212 GTCCACTCAAGTCCAGGAGGAGG - Intergenic
1106631839 13:31482077-31482099 GTCCAGGCCAGGGCAGGGGTTGG + Intergenic
1106687349 13:32074890-32074912 GCCCAGACCAAGCCAGGTGGAGG + Intronic
1107396641 13:40024987-40025009 GTCCAGTCCTGTGCAGGGGGAGG - Intergenic
1108632906 13:52303419-52303441 GGCCAGTTCAACCCAGGTGGGGG + Intergenic
1108653789 13:52509178-52509200 GGCCAGTTCAACCCAGGTGGGGG - Intergenic
1109024322 13:57140447-57140469 GCCAAGTCCAGGCCCGGAGGTGG - Intergenic
1109025309 13:57147017-57147039 GCCAAGTCCAGGCCCGGAGGTGG - Intronic
1109026299 13:57153590-57153612 GCCAAGTCCAGGCCCGGAGGTGG - Intronic
1109027291 13:57160161-57160183 GCCAAGTCCAGGCCCGGAGGTGG - Intergenic
1109028277 13:57166726-57166748 GCCAAGTCCAGGCCCGGAGGTGG - Intergenic
1109029264 13:57173297-57173319 GCCAAGTCCAGGCCCGGAGGTGG - Intergenic
1110350886 13:74505958-74505980 GTCCATGGCAGGCCAGGTGCAGG + Intergenic
1113368829 13:109704586-109704608 GTCCTGTCCACGCCAAGTGTGGG - Intergenic
1118839507 14:69500352-69500374 GTCCAGCCCAGGACAGGGGCAGG - Intronic
1120186183 14:81395974-81395996 GCCGAGGCCAGGTCAGGTGGGGG + Exonic
1121257187 14:92539627-92539649 GACCTGCCCAGGACAGGTGGTGG + Intronic
1121319036 14:92980401-92980423 GTCCACTCCAAGCCAGGTGGAGG + Intronic
1121433931 14:93906508-93906530 GGCCAGGCCAGGGGAGGTGGAGG - Intergenic
1122545196 14:102517893-102517915 GTCCAGTGCTGTCCAGGTGGCGG + Intergenic
1122899375 14:104775931-104775953 GGCCAGACCAGGTCAAGTGGTGG - Intronic
1122982860 14:105199419-105199441 CTGCAGCCCAGGCCAGATGGTGG - Intergenic
1124400541 15:29344157-29344179 GGCCACTCCAGCCCAGGTCGTGG - Intronic
1128112557 15:65085823-65085845 GTCCGGTCCAGCCAGGGTGGTGG - Intergenic
1128161176 15:65423414-65423436 GTCCATTCCAGCCCAGGTCCTGG + Intergenic
1128333612 15:66772077-66772099 ATCCACTCCAAGCCACGTGGGGG - Intronic
1131158540 15:90089826-90089848 AGCCAGTCTAGGCCTGGTGGGGG + Intronic
1132803340 16:1764657-1764679 GCCCACTCCAGGCCACCTGGGGG - Intronic
1132852538 16:2031276-2031298 GCCCAGCCCAGGGCTGGTGGGGG + Intronic
1132877697 16:2147797-2147819 CTCCAGTGCAGCCCAGGTTGGGG + Intronic
1133172219 16:3988430-3988452 TTCCCTTCCAGGGCAGGTGGGGG + Intronic
1133172271 16:3988558-3988580 TTCCTTTCCAGGGCAGGTGGGGG + Intronic
1133287349 16:4696796-4696818 GTGCAGCCCAGGCCCAGTGGGGG - Exonic
1134517531 16:14899194-14899216 GTCCAGTCCCTGGCATGTGGCGG + Intronic
1134705199 16:16297845-16297867 GTCCAGTCCCTGGCATGTGGCGG + Intergenic
1134962342 16:18414269-18414291 GTCCAGTCCCTGGCATGTGGCGG - Intergenic
1134966639 16:18496868-18496890 GTCCAGTCCCTGGCATGTGGCGG - Intronic
1135585583 16:23668485-23668507 GTCCAGGCCAGGCAAGGGGCTGG + Exonic
1136058044 16:27705389-27705411 GTCCAGGCCAGGCCAGCTCAGGG - Intronic
1137378559 16:47976371-47976393 GTCCTCTCCAGGCAATGTGGTGG - Intergenic
1137505649 16:49051793-49051815 GGCCAGGCCAGGCCAGGCAGGGG - Intergenic
1138294790 16:55876922-55876944 CTCCAGCACAGGCCAGGTTGTGG - Intronic
1138546532 16:57722867-57722889 GTCCAGGCCAGCCCAGGGGCGGG + Intronic
1141206431 16:81936399-81936421 GTCCCGTCCCTGCAAGGTGGCGG + Intronic
1141500176 16:84438672-84438694 GTCCAGGTCAGGGCAGGTGAAGG - Intronic
1142156016 16:88533223-88533245 GTCCAGTCCTGGCGATGGGGTGG - Exonic
1144581163 17:16460383-16460405 GACCAGGCAAGGCCAGGAGGAGG - Intronic
1144656443 17:17040228-17040250 CTCCAGTCCAGTGCAGGTGCTGG + Intergenic
1146581225 17:34040192-34040214 GCCCAGGCCAGGTCAGGAGGTGG + Intronic
1147418381 17:40309604-40309626 CTCCAGTCTAGGTGAGGTGGGGG - Intronic
1148199716 17:45741970-45741992 AACCAGACAAGGCCAGGTGGAGG - Intergenic
1150108534 17:62478945-62478967 GCCCAGGCCGGGCCAGGAGGTGG - Intronic
1151323171 17:73363761-73363783 GTCCTGGACAGGCCAGGTTGAGG + Intronic
1151358388 17:73573627-73573649 GTCCAGGCCAGAGCTGGTGGTGG - Intronic
1151748754 17:76025232-76025254 GTCCAGTGCAGGCCTGGTGCAGG + Intronic
1151938943 17:77281153-77281175 GACCAGACCAGGCCAGGCCGGGG - Intronic
1152184152 17:78843660-78843682 GCCCAGGCCCGGGCAGGTGGCGG + Intergenic
1152231065 17:79114437-79114459 GTCGGGTCCAGCCCAGGAGGTGG + Intronic
1152316527 17:79583832-79583854 GTCCAGGCCAGAGAAGGTGGTGG + Intergenic
1152659693 17:81536552-81536574 GTCCAGGCCGGGCGGGGTGGGGG - Exonic
1153041300 18:814877-814899 GAGCAGTCTTGGCCAGGTGGAGG - Intergenic
1155615294 18:27715190-27715212 ATCCAGTCCAGGAGTGGTGGTGG - Intergenic
1160149602 18:76388990-76389012 GTCCAGAACAGGCCCGGGGGAGG + Intronic
1160689294 19:453786-453808 GTGGAGCCCAGGCCCGGTGGGGG - Intronic
1160806497 19:994419-994441 GTCCAGGCCTGGGCTGGTGGGGG - Exonic
1160903169 19:1439213-1439235 GTCCTTTCCAGGCAGGGTGGTGG + Intronic
1160938617 19:1609715-1609737 CCCCAGTCCAGGCCAGGCGGAGG - Exonic
1161349695 19:3784947-3784969 TTCCAGCCCAGGTCAGGTGGGGG + Intronic
1162044770 19:7991253-7991275 GTACTGTCCAGGGCAGGTGCAGG - Intronic
1162354767 19:10175665-10175687 GTCCACTTCAGGCCAGCTGGAGG - Intronic
1162786175 19:13036377-13036399 GTCCTCTCCAGGCCAGGGGTGGG + Intronic
1162967897 19:14164588-14164610 GTCCGGGCCAGGGGAGGTGGGGG - Intronic
1163379732 19:16957256-16957278 GTCCAGCCCGGGCCAGCAGGTGG - Intronic
1164833126 19:31338327-31338349 GTCCACATCAGGCCTGGTGGGGG + Intronic
1165069827 19:33248834-33248856 GACGAGTCCAGGCCAGGTGGAGG + Intergenic
1165434163 19:35787566-35787588 GCCCAGCTCAGGGCAGGTGGCGG + Exonic
1166739326 19:45104546-45104568 GTCCCTGCCATGCCAGGTGGAGG + Intronic
1167166415 19:47802773-47802795 GGCCACCCCAGGCCTGGTGGAGG + Exonic
1168406721 19:56114398-56114420 GGCCTGGCCAGGGCAGGTGGAGG - Intronic
926038562 2:9654591-9654613 GTCCAGCCCAGCCCAGGCAGGGG + Intergenic
927192548 2:20526765-20526787 CCCCAGGCCTGGCCAGGTGGTGG + Intergenic
927209042 2:20627502-20627524 GTGCTGTCCAGACCAGGTGCAGG - Intronic
930707507 2:54519400-54519422 GTCTAATTCAGACCAGGTGGTGG + Intronic
930858456 2:56044253-56044275 GTGAAGTTCAAGCCAGGTGGAGG + Intergenic
933726769 2:85431451-85431473 GACCAGGCCAGGCGAGTTGGAGG - Intronic
937882412 2:126878285-126878307 GTCCTCTCCAGGCCAGGTCTGGG + Intergenic
938063507 2:128269317-128269339 GTCCTGCCAAGGCCTGGTGGTGG + Intronic
938097624 2:128473981-128474003 CTCCAGGCCATGCCAGCTGGAGG + Intergenic
939173455 2:138722661-138722683 GCCCAGTCCAGGCTAGTAGGTGG + Intronic
940187127 2:150998087-150998109 GTCCAGTCCAGGCATGGAGGAGG - Intergenic
944271058 2:197785749-197785771 ACCCAGTCCAGGCCCCGTGGCGG + Intronic
945199694 2:207268778-207268800 GTCCAGTACTTGCCAGGTAGTGG - Intergenic
945220819 2:207482114-207482136 GGGCAGTCCAGGGCAGGTGCTGG - Intergenic
947363417 2:229369521-229369543 GTCCACTCCTGGACATGTGGTGG + Intronic
948600257 2:239103860-239103882 GTCCTGTCCATGCAGGGTGGAGG + Intronic
948822116 2:240555327-240555349 GTCCAGCCCGGGCCTGCTGGCGG + Intronic
1169017324 20:2302502-2302524 GTTCTGGGCAGGCCAGGTGGTGG + Intronic
1170569089 20:17622795-17622817 GGCCAGGCCTGTCCAGGTGGTGG - Intronic
1170816667 20:19720139-19720161 GTACTGTCCAGCCCAGGTGTAGG - Intronic
1171035647 20:21710536-21710558 TTCCAGCCCTGGACAGGTGGAGG - Intronic
1171852196 20:30316685-30316707 GGCCGGGCCAGGCCAGGCGGAGG - Intergenic
1172008791 20:31834452-31834474 GCCCAGCCCAGGCCTGGTGGAGG + Exonic
1172706652 20:36887142-36887164 GAGCAGTCCAGGCCAGGAGTGGG - Intronic
1173856920 20:46256197-46256219 GTAGAGTCCTTGCCAGGTGGGGG + Intronic
1175298113 20:57923329-57923351 GCCCAGCCCAGGGCAGGTGATGG - Intergenic
1175300806 20:57941437-57941459 ATCCAGGCCAGGCAGGGTGGGGG + Intergenic
1175368644 20:58471905-58471927 CTCCAGTCCAGGGGATGTGGGGG + Intronic
1175554203 20:59836209-59836231 GTCCAGACCAGGCAAGGTTTGGG + Intronic
1175703972 20:61162058-61162080 GTCAAGTTCAGGGAAGGTGGGGG - Intergenic
1178363769 21:31971357-31971379 TTCCAGGCCAGGCACGGTGGTGG - Intronic
1178639575 21:34335249-34335271 ATCCAAGCCAGGCCAGATGGAGG - Intergenic
1179654508 21:42837120-42837142 GTCCGGTCCAGACCAGGGTGAGG + Intergenic
1179930698 21:44569072-44569094 CTCCACTCCAGGCCAGGAGAAGG + Intronic
1180174801 21:46082335-46082357 CCCGAGGCCAGGCCAGGTGGGGG + Intergenic
1180842634 22:18966376-18966398 ATCCAGTCCAGGGCTGGGGGAGG + Intergenic
1182068638 22:27447634-27447656 GGACAGTCCAGGCCAGGACGAGG + Intergenic
1183705642 22:39473664-39473686 GGCCAGGCCAGGCTAGCTGGAGG + Intronic
1184731599 22:46373775-46373797 GTCCAGAGCAGGCCGGTTGGGGG - Intronic
1184891944 22:47385206-47385228 CTCCAGACAAGGTCAGGTGGTGG + Intergenic
1185340187 22:50287612-50287634 CCCCAGGCCGGGCCAGGTGGGGG - Intronic
950449230 3:13056242-13056264 GTCCAGTACAGGCTTGGGGGAGG + Intronic
952131940 3:30374150-30374172 GTCAAGTTCAGGAGAGGTGGAGG + Intergenic
952382677 3:32817224-32817246 GCCCAGGCCAGGCGAGGCGGGGG + Intergenic
952423538 3:33152512-33152534 GTCAATTCCAGGGCAGATGGTGG + Exonic
952967777 3:38631784-38631806 GTGGAGTGCAGGCCAGGTTGGGG - Intronic
953911223 3:46893994-46894016 GTCCTGCAGAGGCCAGGTGGGGG + Exonic
954068309 3:48124624-48124646 GGCCAGGCCAGGCCAGATGCTGG - Intergenic
954367503 3:50154508-50154530 CTCCAGCCTAGGCCAGGTCGGGG - Intergenic
958196107 3:90244417-90244439 GTCAAGGACAGACCAGGTGGAGG + Intergenic
958777812 3:98506715-98506737 GTGAAGTCCAGGCCACATGGAGG - Intronic
961160681 3:124722165-124722187 GTGCAGACCACGGCAGGTGGGGG + Intronic
961565988 3:127763633-127763655 GTCCACTCCAGGCCAGGTCAGGG - Intronic
961722962 3:128908317-128908339 GGCCAGTCCAGGGCAGTGGGAGG + Intronic
966329081 3:178790681-178790703 GTCCAGTGCAGTCCCAGTGGTGG + Intronic
968513318 4:1004690-1004712 TTCCAGTCCAGGCTTGGGGGTGG - Intergenic
968556352 4:1248216-1248238 GCCCAGGCAAGGGCAGGTGGGGG + Intronic
968759020 4:2432574-2432596 GTCCAGGCCGGGGCAGGTTGGGG - Intronic
972396292 4:38662631-38662653 GTCCAGGAAAGGCCACGTGGAGG - Intergenic
979195587 4:117916731-117916753 GTCCAGGCAAAGCCAGATGGGGG + Intergenic
979496803 4:121392910-121392932 GGCCAGTCCAGGCTAGGGGCTGG + Intergenic
982658375 4:158176662-158176684 GTGCTGTCCAGGCCTGGTGTTGG - Intergenic
988497576 5:31758145-31758167 GTGCGGTCCAGGGCAGGAGGAGG - Intronic
989192360 5:38683743-38683765 GTCCACTCCAGGTAGGGTGGTGG - Intergenic
989379257 5:40797871-40797893 GGCCAGCACAGGCCGGGTGGGGG - Intronic
992230562 5:74659373-74659395 CCCCAGTGCAGGGCAGGTGGAGG + Intronic
996727542 5:126685741-126685763 GTCCTTTCTAGGCCAGGTTGTGG + Intergenic
1000372530 5:160550739-160550761 GTCCAGTTCAGGCCACCTTGAGG + Intergenic
1001939573 5:175731024-175731046 CTCCAGGCCAGGCCAGGGGATGG - Intergenic
1003115515 6:3281286-3281308 CTCAGGCCCAGGCCAGGTGGTGG - Intronic
1006676976 6:35771513-35771535 GGCCAGCCCAGTCCAGGAGGAGG + Intergenic
1006853160 6:37114046-37114068 GACCAGCCCAGGCAACGTGGTGG + Intergenic
1007468882 6:42075247-42075269 GTTCAGGCCAGACCAGGTGCCGG - Intronic
1007769204 6:44179825-44179847 GTCCAGGCCAGGTCAGTTGGTGG + Intronic
1012631971 6:101481814-101481836 GTCAAGGGGAGGCCAGGTGGAGG + Intronic
1014191480 6:118501291-118501313 GTCCAGGCCAGGCGAGGTGGAGG + Intronic
1019276943 7:180583-180605 GTCCAGCCCCGGCCAGGCGATGG - Intergenic
1019339616 7:502713-502735 GCCCAGTCCAGGCCAGAGAGGGG + Intronic
1020343225 7:7134995-7135017 GACCAGTCCAGGCTAAGTGTTGG + Intergenic
1023166699 7:37350034-37350056 CTCCAGTGTAGGGCAGGTGGGGG - Intronic
1023883408 7:44334508-44334530 GTCCTGGCCAGGCCTGGGGGCGG + Intronic
1024000783 7:45188110-45188132 GGGCAGTCCAGGCAACGTGGGGG + Intergenic
1024281888 7:47725251-47725273 GAGCTGGCCAGGCCAGGTGGGGG + Intronic
1026909222 7:74083077-74083099 GTCCAGTCCAGCACTGATGGTGG - Intronic
1028690118 7:93641664-93641686 GTAAATTCCTGGCCAGGTGGGGG - Intronic
1029550107 7:101232933-101232955 CCCCAGTCCAGTCCAGGGGGAGG + Intronic
1030268348 7:107643959-107643981 GTTCAGTCCAGGCGAGATGCTGG + Intergenic
1031088337 7:117324351-117324373 GGCCAGTCCAGGCCCGAGGGTGG - Intergenic
1032037570 7:128531486-128531508 GCCCAGGCCGGGCCAGGAGGTGG - Intergenic
1034419217 7:150980149-150980171 CTCCTGTCCAGGCCAGGGGATGG + Intergenic
1037186345 8:16068041-16068063 GCCCAATCCAAGCCAGTTGGAGG + Intergenic
1037605744 8:20435745-20435767 GTGAAGTCCTGGCCAGGTGAGGG + Intergenic
1040107770 8:43550014-43550036 GTCCTGTCCCGGTCAGGCGGGGG + Intergenic
1048343780 8:133560973-133560995 ATGCAGCCCAGCCCAGGTGGAGG + Intronic
1048974323 8:139662568-139662590 GTCCAGTCCAGGCCAGCAGAAGG - Intronic
1049024491 8:139979376-139979398 GCCCAGCACAGGCCAGATGGAGG + Intronic
1049240945 8:141537088-141537110 GCCCAGGCCAGCCCAGGTGGAGG - Intergenic
1049360895 8:142212182-142212204 GTCCATTGCAGGCCAAGTGACGG + Exonic
1049368616 8:142252947-142252969 GTCCACTCCGGCCCAGGTGTGGG + Intronic
1049689845 8:143953642-143953664 GTGCAGTCCACGCAGGGTGGCGG - Intronic
1049817775 8:144615908-144615930 CTCCAGGACAGGCCAGGTTGAGG + Intergenic
1050038285 9:1460906-1460928 GTACAGTCCAGGCTAGGCAGAGG + Intergenic
1053311991 9:37026208-37026230 CTCCGGGCCAGGCCAGTTGGAGG - Intronic
1056091158 9:83207368-83207390 CTTCAGTCCATCCCAGGTGGTGG + Intergenic
1056735276 9:89204443-89204465 GTCCAGTCCAGGCTGGGGAGAGG + Intergenic
1056755142 9:89376986-89377008 GTCCTGTCTGGGCCATGTGGGGG - Exonic
1057314854 9:93961513-93961535 TTCCAGTCCTGGCAAGGTGGTGG - Intergenic
1058954402 9:109931992-109932014 GTCCCGTCCTGCCCAGGTGATGG - Exonic
1060404062 9:123364482-123364504 TTCCATTCCAAGCCGGGTGGGGG + Intronic
1060634514 9:125189537-125189559 ATCCAGTCCAGTCGCGGTGGAGG - Intronic
1061291152 9:129651034-129651056 GTTCACTCCTGCCCAGGTGGAGG - Intergenic
1061294108 9:129667647-129667669 CTCCAGTCCTGGCCAGGGGACGG + Intronic
1061899819 9:133667033-133667055 CTGCTGTCCAGGCCAGGTGCTGG - Intronic
1062142029 9:134964532-134964554 TTCCAGTCCAGGAAAGGAGGGGG + Intergenic
1062414061 9:136439177-136439199 CTCCAGTCGAGGCCTGGCGGGGG + Exonic
1186409006 X:9329377-9329399 GTCAGGTTAAGGCCAGGTGGGGG + Intergenic
1187258923 X:17667483-17667505 GTGCATTCCAGGCCCTGTGGAGG - Intronic
1189317316 X:40065194-40065216 CTACAGTCCAGGCCAGAGGGAGG + Intronic
1189344735 X:40232432-40232454 GTCCTGTCCAGGGCAGGGGGTGG + Intergenic
1190338528 X:49278233-49278255 GTCCGGACTAGGCCAGATGGAGG + Intronic
1190739999 X:53282388-53282410 CTCCAGTCCCGCCCATGTGGAGG - Intronic
1192236663 X:69300548-69300570 GGACAGCCCTGGCCAGGTGGGGG + Intergenic
1192954325 X:76052580-76052602 GTACCCTCCAGGCCAGGTGCAGG + Intergenic
1195129636 X:101840004-101840026 TGCCAGCCCAGGACAGGTGGGGG + Intronic
1195176602 X:102319825-102319847 TGCCAGCCCAGGACAGGTGGGGG - Intronic
1195182262 X:102367268-102367290 TGCCAGCCCAGGACAGGTGGGGG + Intronic
1195202467 X:102564516-102564538 TGCCAGCCCAGGACAGGTGGGGG - Intergenic
1199673600 X:150166370-150166392 GCCCTGTCCAGGTCAGCTGGAGG + Intergenic
1200106998 X:153719865-153719887 GATAAGGCCAGGCCAGGTGGTGG - Intronic
1200163832 X:154022689-154022711 TTCCTGGACAGGCCAGGTGGTGG - Intronic