ID: 1077121159

View in Genome Browser
Species Human (GRCh38)
Location 11:909275-909297
Sequence GGGAAGAAACGGTTTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077121159_1077121167 10 Left 1077121159 11:909275-909297 CCTGCATCAAACCGTTTCTTCCC 0: 1
1: 0
2: 2
3: 9
4: 118
Right 1077121167 11:909308-909330 TGACCTTCCCTTGGGCAGAACGG 0: 1
1: 0
2: 1
3: 30
4: 310
1077121159_1077121171 25 Left 1077121159 11:909275-909297 CCTGCATCAAACCGTTTCTTCCC 0: 1
1: 0
2: 2
3: 9
4: 118
Right 1077121171 11:909323-909345 CAGAACGGCCCCGCACACAAAGG 0: 1
1: 0
2: 0
3: 5
4: 57
1077121159_1077121165 2 Left 1077121159 11:909275-909297 CCTGCATCAAACCGTTTCTTCCC 0: 1
1: 0
2: 2
3: 9
4: 118
Right 1077121165 11:909300-909322 AATGCCAATGACCTTCCCTTGGG 0: 1
1: 0
2: 1
3: 13
4: 157
1077121159_1077121164 1 Left 1077121159 11:909275-909297 CCTGCATCAAACCGTTTCTTCCC 0: 1
1: 0
2: 2
3: 9
4: 118
Right 1077121164 11:909299-909321 AAATGCCAATGACCTTCCCTTGG 0: 1
1: 0
2: 4
3: 12
4: 171
1077121159_1077121172 26 Left 1077121159 11:909275-909297 CCTGCATCAAACCGTTTCTTCCC 0: 1
1: 0
2: 2
3: 9
4: 118
Right 1077121172 11:909324-909346 AGAACGGCCCCGCACACAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077121159 Original CRISPR GGGAAGAAACGGTTTGATGC AGG (reversed) Intronic
901386101 1:8910331-8910353 GGGAAGCAATGGTTGGATTCAGG + Intergenic
906939098 1:50240095-50240117 GGAAAGAAGCGGTGTGAAGCAGG + Intergenic
912265332 1:108151502-108151524 GGAAGGAAACGGTTTCATGGGGG - Intronic
922418085 1:225439973-225439995 GGGAAAATACGGTTTGAGGATGG + Intergenic
924328150 1:242916226-242916248 GGGAAGAAAGGCTTTAATGCAGG - Intergenic
1063413743 10:5856716-5856738 GAGCAGAAACGCTTTGGTGCAGG - Intergenic
1068633226 10:59320025-59320047 AGGAAGAAAAGGATTGAAGCAGG + Intronic
1070501446 10:77076407-77076429 GGAGAGAAACGCTTTCATGCTGG - Intronic
1072627071 10:97119400-97119422 GGGACAAAATGATTTGATGCAGG + Intronic
1073138391 10:101232051-101232073 GGGAAGAAGAGGTTTGGTGTTGG - Intergenic
1076198113 10:128535271-128535293 GGGAAGAAACAGTTAAATGAGGG + Intergenic
1077121159 11:909275-909297 GGGAAGAAACGGTTTGATGCAGG - Intronic
1078760565 11:14248080-14248102 GGGAAGAAAGTGTTTGAGGCGGG + Intronic
1079962712 11:26943806-26943828 GGGAAGAAAGGGTTTAGTGCTGG - Intergenic
1080381850 11:31779874-31779896 AGGAAGAGACTGTGTGATGCAGG - Intronic
1080456605 11:32425205-32425227 GGGAAGAAAAAGTTTGGTGAGGG + Intronic
1087204507 11:95379723-95379745 GGCAATAAACAGATTGATGCTGG + Intergenic
1092281820 12:7103183-7103205 GGGAAGAAGCAATTTGATGTAGG + Intronic
1093438466 12:19164840-19164862 GGAAAAAAAGGGTTTGAAGCTGG - Intronic
1095199397 12:39364827-39364849 GGGAAGAAGAGGTTTGTTTCAGG - Intronic
1095280225 12:40342633-40342655 GGGAAGAAAAAGTTTGGTGATGG - Intronic
1095377834 12:41552069-41552091 GGAAAGAAATGGTTTCATCCAGG - Intronic
1099856369 12:88172627-88172649 GGAAAAAAAAGGTTCGATGCAGG - Exonic
1105444236 13:20438635-20438657 GGGAAGAGAGGGTCTGAGGCTGG - Intronic
1105480685 13:20773112-20773134 AGGAAGGAACTGTTTGAGGCAGG - Intronic
1106777305 13:33020702-33020724 GGGGAGAAGTGGTTTGATTCTGG - Intronic
1107175252 13:37392208-37392230 GGGAAGAAGCTGTTGGATTCTGG + Intergenic
1110921912 13:81099093-81099115 TGCAAGCAACGGTCTGATGCAGG - Intergenic
1116365948 14:44063336-44063358 GGGAAGAACTGGATTGGTGCAGG + Intergenic
1118179209 14:63474376-63474398 GGGAAGAAATAGTTTGGTGGGGG + Intronic
1119849132 14:77854197-77854219 GGGAAGAACAGGTTTGGTGGTGG + Intronic
1121566443 14:94913496-94913518 GGAAAGAAAGGGTTGGATTCTGG + Intergenic
1121766771 14:96494624-96494646 GGGAAGAAAGTGTTTGAAGGAGG - Intergenic
1124947366 15:34282189-34282211 GGTAAGAAACGGTTTGGGGCAGG + Intronic
1126669083 15:51099914-51099936 GGGAAGAAAGGAGTTGATTCCGG + Intronic
1127830142 15:62743388-62743410 GGGAAGAAAAGGTTTGCTTCTGG + Intronic
1128548390 15:68582353-68582375 GGGAAGGAAGGCTCTGATGCAGG + Intronic
1131521452 15:93119076-93119098 GGAAAGAGACAGTTTGATGTTGG - Intergenic
1131939538 15:97545796-97545818 GGGAAGAAAGGCTTTAATGTTGG + Intergenic
1141200129 16:81891365-81891387 GGGAAGAACAGCTCTGATGCGGG - Intronic
1141670905 16:85491262-85491284 GTGAAGAAACAGATTGATCCTGG - Intergenic
1144150477 17:12438569-12438591 GCGAAGAAACAGTTTCATGGAGG - Intergenic
1147735657 17:42636348-42636370 GGGAAGAAGCAGCTTGCTGCAGG - Intergenic
1149418428 17:56484528-56484550 GGGAAAAAATGGTTTGCTGAAGG + Intronic
1149898201 17:60447813-60447835 GGGAAGAAACTTTTTGGTGAGGG - Exonic
1150832361 17:68535540-68535562 GGGAAGAAACATCTTGAAGCAGG + Intronic
1151052694 17:70996403-70996425 GGGAAGAAAGCTTGTGATGCTGG - Intergenic
1152920758 17:83065379-83065401 GGGAAGAAAAGGTTGGGGGCTGG + Intergenic
1153091241 18:1346347-1346369 TGGAATAAACGGTTTGATTTAGG + Intergenic
1153607386 18:6847961-6847983 TGGTAGAAACAGTTTGTTGCTGG - Intronic
1153804008 18:8696162-8696184 GGGAAGAAAGGCTTTAATGCAGG + Intergenic
1159099218 18:63939751-63939773 GGGATGAAAAGATTTGATGTGGG + Intergenic
1160960823 19:1720067-1720089 GGGAAGGAGCGATTTGATTCAGG - Intergenic
1164441988 19:28285422-28285444 GGGAAGAAAAGGTTGGAGGGTGG + Intergenic
1164537923 19:29100174-29100196 GGGAAGAAAGGCTTTGTTGTGGG - Intergenic
927153754 2:20210321-20210343 GGGAAGAAACAGTCTGGTCCTGG + Intronic
929489519 2:42384031-42384053 GGGAAGAAGGGGATTGAGGCTGG - Intronic
938930663 2:136084001-136084023 GGGAAGAAAGTGTTTGAAGAAGG - Intergenic
939470663 2:142615983-142616005 GGGAAGATACAGCTTGGTGCGGG + Intergenic
939575903 2:143894096-143894118 GAGAAGAAAAGGGTGGATGCAGG + Intergenic
941503716 2:166313516-166313538 GGAAAAAAAAGGTTTGAAGCTGG - Intronic
942690925 2:178584432-178584454 GGAAAGAAACAGTTTGCTGTGGG - Exonic
943852130 2:192737472-192737494 GGGAAGAAAAGGTTAAATGGAGG - Intergenic
1168753408 20:299122-299144 GGGAAGAAAAGGTATGGGGCGGG - Exonic
1175974778 20:62705226-62705248 GGGAAGAGAAGGTTGGAGGCTGG + Intergenic
1176222544 20:63976910-63976932 GGGAAGAGACGCTCTGAGGCAGG + Intronic
1178412662 21:32378374-32378396 TGGAAGAAACGGTTTGCAGTAGG + Intronic
1179285086 21:39970319-39970341 GGGAAGAAAGGCTTTATTGCAGG - Intergenic
1179399511 21:41070819-41070841 AGGAAGAGACGGTATGATGAGGG + Intergenic
1180162398 21:46004027-46004049 GGGAGGACAGGGTTTGGTGCCGG - Exonic
1183797281 22:40130160-40130182 GGGAAGAAATGGGTTGAGGAAGG + Intronic
1184995497 22:48204426-48204448 GGGAAGCTACAGTTAGATGCAGG + Intergenic
950876580 3:16280221-16280243 GGGTAGAGAGGGTGTGATGCAGG + Intronic
954360052 3:50117143-50117165 CGCAAGAAGCAGTTTGATGCCGG + Exonic
954903163 3:54037426-54037448 GGGAAGATAAGTTTTGATGGTGG + Intergenic
956242125 3:67142264-67142286 GGGAAGATAGAGTTTGATGGGGG - Intergenic
960990675 3:123309110-123309132 GGTAAGGAACAGTTTGATCCTGG + Intronic
961687740 3:128646359-128646381 GTGAAGAAACAGTTTTAGGCTGG - Intronic
963752989 3:149202249-149202271 GGGAAAAAAGTGTTTAATGCTGG + Intronic
966578715 3:181534816-181534838 AGGAAGAAATGGTATCATGCAGG - Intergenic
970690790 4:18618246-18618268 TGGAAGAAAGGGTTTGAAGTGGG + Intergenic
971371124 4:26019810-26019832 GAGAAGAAATGTTTTGATGTGGG - Intergenic
972764831 4:42142791-42142813 GCCAAGAAACGGTTTGGGGCCGG + Intronic
973547858 4:52000152-52000174 GAGAAGAAATGGTATGATTCTGG + Intronic
973830915 4:54757877-54757899 GGTAAGAAATGGTTAGATTCAGG + Intergenic
975852668 4:78588446-78588468 GGGAACAAAAGGATTCATGCAGG + Intronic
976688717 4:87845232-87845254 GGGAATAAAGGGTTTGAGGATGG + Exonic
978542267 4:109830596-109830618 GGGAAGAACAGGTTTGAGGCAGG + Intronic
981415728 4:144490941-144490963 GGGACAAAACGGTGTGGTGCTGG - Intergenic
981429504 4:144644153-144644175 GGGAAGAAAGGGTTAGATAGTGG + Intergenic
982562214 4:156943595-156943617 GAAAAAAAAAGGTTTGATGCAGG - Intronic
983960926 4:173752869-173752891 AGGAAGAAAGGGTTTGGGGCTGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
999268451 5:150282274-150282296 CGGAAGAATCTGTTTGCTGCAGG + Intronic
1000275724 5:159733207-159733229 GGGAAGAAAAGGCTTGATGCAGG - Intergenic
1004732047 6:18367634-18367656 GGAAAGAACCTGATTGATGCTGG - Intergenic
1006044701 6:31284560-31284582 GGGAAGAAAGAGTTTATTGCTGG - Intronic
1007893763 6:45325178-45325200 AGGAGAAAATGGTTTGATGCAGG - Intronic
1008250663 6:49235932-49235954 GGGAAGAAATGGTGTAATGAAGG + Intergenic
1008301751 6:49849474-49849496 GGGAAGAAAGGCTTTCATGAGGG - Intronic
1013385306 6:109623812-109623834 GGGAAGAAAAAGTTTTATCCAGG - Intronic
1016657797 6:146542209-146542231 GGGAAGAAACGGAATGATGCAGG - Intergenic
1017757889 6:157545027-157545049 GGGAAGAAAAGTATTGATACAGG + Intronic
1017809458 6:157974527-157974549 GGTGAGAAACGGTTGGATTCTGG - Intergenic
1022948018 7:35307019-35307041 GGGAAGAACTGGTTTAATGTTGG - Intergenic
1023386077 7:39659165-39659187 GGGATGAAATGGTCTGAGGCAGG + Intronic
1024609831 7:51054947-51054969 GGGAAGAAAGGTTTGGATCCTGG - Intronic
1028332999 7:89620743-89620765 GGGAAGAAATGATTTGAAGTGGG - Intergenic
1030598232 7:111563845-111563867 GGGAAGACAGGCTTTAATGCAGG - Intergenic
1031392073 7:121227247-121227269 GAGAAGAAACGGATGGATGTAGG - Intronic
1032322422 7:130897431-130897453 GGGATGAAGCGGTTCGATGAAGG + Intergenic
1037420658 8:18698485-18698507 GGGAAGAAGAGGTTTGAAGGTGG + Intronic
1038307703 8:26419839-26419861 GGGGAGAAGCGCTTTGGTGCTGG - Intronic
1040564272 8:48552128-48552150 GGGAAGAAACTGATTCATGCAGG - Intergenic
1041816809 8:61982340-61982362 AGGAAGAAAGGCTTTAATGCGGG - Intergenic
1041970859 8:63740924-63740946 GGGAAGAGACAGTTTACTGCTGG - Intergenic
1043446466 8:80324527-80324549 GGGAAAAAAGAGTTTGATTCTGG + Intergenic
1045686715 8:104720209-104720231 GGCAAGAAGTGGTTTGATTCTGG + Intronic
1049106952 8:140620012-140620034 GGGATGAAACGGGCTGGTGCAGG + Intronic
1049948780 9:624228-624250 TGGGAGAAACGGTGAGATGCTGG + Intronic
1051809989 9:21037525-21037547 GGAATGAAATGGTTTCATGCTGG - Intergenic
1056618587 9:88190948-88190970 GTGAAGAAACGCTTTGAGGATGG - Intergenic
1056808569 9:89746713-89746735 GTGGAGAAACGGTTTGTTGGTGG - Intergenic
1057309068 9:93930327-93930349 GGGAGGAAACGGCTTCAGGCAGG + Intergenic
1059238591 9:112783805-112783827 TGGAAAAAACGGTTTGAATCAGG + Intronic
1060777271 9:126384319-126384341 AGGAAGAAACGGTTTCCTGATGG + Intronic
1195431079 X:104790247-104790269 GGGAAGAAAAAGATGGATGCTGG + Intronic
1199164469 X:144654476-144654498 GAGAAAAAACAGGTTGATGCAGG + Intergenic
1200962105 Y:9005097-9005119 GGAATGAAATGGATTGATGCTGG + Intergenic
1201225545 Y:11815191-11815213 GGGAAGAAAGGCTTTAATGCAGG - Intergenic