ID: 1077122314

View in Genome Browser
Species Human (GRCh38)
Location 11:915299-915321
Sequence GCTGATGCTGAGCCCCGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077122304_1077122314 26 Left 1077122304 11:915250-915272 CCGGCCCTGGCCAGTGACAGTTG No data
Right 1077122314 11:915299-915321 GCTGATGCTGAGCCCCGAGGTGG No data
1077122308_1077122314 16 Left 1077122308 11:915260-915282 CCAGTGACAGTTGCGTGTAGGTG No data
Right 1077122314 11:915299-915321 GCTGATGCTGAGCCCCGAGGTGG No data
1077122305_1077122314 22 Left 1077122305 11:915254-915276 CCCTGGCCAGTGACAGTTGCGTG No data
Right 1077122314 11:915299-915321 GCTGATGCTGAGCCCCGAGGTGG No data
1077122306_1077122314 21 Left 1077122306 11:915255-915277 CCTGGCCAGTGACAGTTGCGTGT No data
Right 1077122314 11:915299-915321 GCTGATGCTGAGCCCCGAGGTGG No data
1077122303_1077122314 30 Left 1077122303 11:915246-915268 CCAGCCGGCCCTGGCCAGTGACA No data
Right 1077122314 11:915299-915321 GCTGATGCTGAGCCCCGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077122314 Original CRISPR GCTGATGCTGAGCCCCGAGG TGG Intergenic
No off target data available for this crispr