ID: 1077129285

View in Genome Browser
Species Human (GRCh38)
Location 11:962034-962056
Sequence TCGCCGCCACCTGCCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077129279_1077129285 28 Left 1077129279 11:961983-962005 CCACTAGTGAAAAGTAAAGGGCG 0: 1
1: 6
2: 8
3: 3
4: 65
Right 1077129285 11:962034-962056 TCGCCGCCACCTGCCCATCAGGG 0: 1
1: 0
2: 0
3: 4
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077129285 Original CRISPR TCGCCGCCACCTGCCCATCA GGG Intronic
900793613 1:4694646-4694668 TTACCTCCACCTGCCCACCAAGG - Intronic
900965231 1:5952795-5952817 TCGCCTCCAGAAGCCCATCACGG - Exonic
901632906 1:10656595-10656617 TCTCCGCCACCAGCACAGCATGG - Intronic
902459169 1:16559320-16559342 TCTCCACTACCTGCCCTTCAGGG + Intergenic
902821911 1:18948611-18948633 TTGCCGCCGCCTGCCCACGAGGG - Intronic
903152365 1:21420002-21420024 TCTCCACTACCTGCCCTTCAGGG + Intergenic
903467067 1:23559126-23559148 TGGCCCCCACCTTCCCATCCAGG - Exonic
905309661 1:37040583-37040605 TGGCAGCCTCCTGCCCATGAGGG - Intergenic
905878942 1:41451081-41451103 TCCCTGCCACCTGCCCTGCAGGG + Intergenic
905901076 1:41582288-41582310 TCACCCCCACCTGCCCCACACGG - Exonic
913286383 1:117230509-117230531 TCACCACCACCAGGCCATCATGG + Intergenic
914433042 1:147636942-147636964 TGGCCACCACCATCCCATCATGG - Intronic
915502933 1:156331955-156331977 TCGCCGCAACCTCCCCCTCTCGG - Intronic
916860344 1:168797055-168797077 TCGCTGCCACCTGCACCTCCTGG - Intergenic
922461938 1:225819973-225819995 CCGCAGCCACCAGCTCATCAAGG + Intronic
1063995054 10:11611396-11611418 CCGCCGCCGCCGGCCCCTCACGG + Intronic
1070544577 10:77442352-77442374 CCCCCGCCACCTCCCCATCTAGG + Intronic
1073541618 10:104319832-104319854 TCGGCTCCTCCTTCCCATCATGG - Intronic
1075924493 10:126239863-126239885 TGGATTCCACCTGCCCATCATGG - Intronic
1077129285 11:962034-962056 TCGCCGCCACCTGCCCATCAGGG + Intronic
1083654157 11:64220935-64220957 GAGCCCCCACCTCCCCATCAGGG - Intronic
1083911596 11:65713129-65713151 GAGCCGCCTCCTGCCCATCCAGG - Intronic
1087131711 11:94674342-94674364 TCGCCTCCACCTGCCCTCCCAGG - Intergenic
1087182801 11:95156370-95156392 TCTCCTCCACCAGCTCATCATGG + Intergenic
1089748659 11:120634760-120634782 TCGCCCCCTCCTGCCCACGAGGG - Intronic
1091240768 11:134050727-134050749 GCGCCGCCTCCTGCCCACCCCGG - Intergenic
1093473937 12:19534232-19534254 TCGCCAACCCCTGCCCTTCATGG - Intronic
1094200220 12:27787418-27787440 TCACCGCAACCTCCCCATCCCGG - Intronic
1097201065 12:57279255-57279277 TCGCCGCAACCTCCGCCTCATGG + Intronic
1103232663 12:119344958-119344980 TGGCCACCACCTCCCCATCCAGG + Intronic
1103319362 12:120082325-120082347 TCACTGCAACCTCCCCATCATGG + Intronic
1106431865 13:29688287-29688309 CCTCCGGCACCTGACCATCATGG - Intergenic
1106459164 13:29953475-29953497 TCTCCCCCACCACCCCATCAAGG - Intergenic
1106484153 13:30157856-30157878 TGGCCGCCTCCTGCACAGCAGGG + Intergenic
1111523162 13:89431200-89431222 TCACTGCAACCTCCCCATCATGG + Intergenic
1121324747 14:93013386-93013408 CAGCCTCCACCTGCCCACCAGGG + Intronic
1122183916 14:99974927-99974949 TCTCCTCTCCCTGCCCATCAAGG - Intronic
1122424986 14:101600760-101600782 AGGCAGCCACCTCCCCATCATGG + Intergenic
1122638475 14:103142214-103142236 ATGCCGCCACCTGGCCATCTGGG - Intergenic
1125003597 15:34795414-34795436 GCGCCGCCACCTGGCCAGCCCGG - Intronic
1125074639 15:35599267-35599289 TCAACCCCACCCGCCCATCAAGG - Intergenic
1125716654 15:41823340-41823362 TCCCCTCCACATGCCCATTAAGG - Intronic
1129453607 15:75664238-75664260 TACCCACCACCTGCCCCTCACGG - Intergenic
1130550909 15:84889385-84889407 CCACCACCCCCTGCCCATCACGG - Intronic
1132142480 15:99407178-99407200 TCCCCACCTCGTGCCCATCATGG + Intergenic
1132244789 15:100286047-100286069 TAGCTGCCATCTGCCCATGAAGG - Intronic
1132871435 16:2117357-2117379 CCGGCGCCACCTGCTCACCAGGG + Intronic
1134058052 16:11182484-11182506 GGGCAGCCACCTGCCCAACAGGG - Intergenic
1134521093 16:14919537-14919559 CCGGCGCCACCTGCTCACCAGGG - Intronic
1134550478 16:15136435-15136457 CCGGCGCCACCTGCTCACCAGGG + Intronic
1134708769 16:16318188-16318210 CCGGCGCCACCTGCTCACCAGGG - Intergenic
1134715983 16:16358222-16358244 CCGGCGCCACCTGCTCACCAGGG - Intergenic
1134950836 16:18350457-18350479 CCGGCGCCACCTGCTCACCAGGG + Intergenic
1134958773 16:18393937-18393959 CCGGCGCCACCTGCTCACCAGGG + Intergenic
1136572070 16:31104198-31104220 TCCCCGCCGCCTTCCCATCTAGG + Intergenic
1138172297 16:54864160-54864182 TGGCCTCCGCCTACCCATCAAGG + Intergenic
1139605773 16:68017252-68017274 TCACCGCAACCTCCCCTTCAAGG + Intronic
1142177790 16:88652869-88652891 TTGCCGCCACCTTCCTCTCAGGG - Intronic
1142259534 16:89036319-89036341 TGGCCTCCACCTGGCCCTCATGG - Intergenic
1142818502 17:2447146-2447168 TCCCCGCCGCCTTCCCATCTAGG + Intronic
1144788158 17:17843216-17843238 TGGCCTCCTCCTGCCCATCTGGG + Intergenic
1145991941 17:29084720-29084742 GCGCTGCCACCAGCCCATCCTGG + Intronic
1146216486 17:30980793-30980815 TCCCCGCCACCATCCCATCTAGG - Intronic
1151310207 17:73288133-73288155 TAGCCACCACCTGCCCCCCACGG + Intronic
1152896396 17:82913831-82913853 TTGCTGCCACCTACCCATGATGG + Intronic
1160235102 18:77079271-77079293 GCACTGCCATCTGCCCATCAGGG - Intronic
1160988004 19:1848428-1848450 TCGCCGCCGCCCGCGCCTCACGG + Exonic
1161482525 19:4518094-4518116 CCGCCCCCACCAGCCCACCAGGG + Intergenic
1164759247 19:30716393-30716415 TCCCAGCCACCTGACCATGAGGG - Intergenic
1202675416 1_KI270711v1_random:1504-1526 TCTCCACTACCTGCCCTTCAGGG + Intergenic
1202708305 1_KI270714v1_random:564-586 TCTCCACTACCTGCCCTTCAGGG - Intergenic
925403689 2:3591676-3591698 TCCCCGCCGCCTTCCCATCTAGG - Intergenic
927584074 2:24282730-24282752 TCCCCATCACCTGCCCTTCAAGG + Intronic
930754881 2:54964039-54964061 TGGCCACCATCTCCCCATCAGGG - Exonic
935083681 2:99824188-99824210 TCGCCGCAACCTCCACATCCAGG + Intronic
935217523 2:100986256-100986278 GCTCAGCCACCTGCCCATCTCGG + Intronic
936389034 2:112055311-112055333 TCGCCGCCAACTCCACATCCTGG + Exonic
936954871 2:118013758-118013780 CCGCCGCCCCCTGCCCATGCAGG + Intronic
940643200 2:156368126-156368148 TCCCCGCCACCATCCCATCTAGG + Intergenic
942172252 2:173299812-173299834 TGGCCCCCAACAGCCCATCAGGG - Intergenic
944041235 2:195357409-195357431 TCCCCTCCTCATGCCCATCATGG - Intergenic
944270953 2:197785343-197785365 CCGCCGCCAGCAGCCAATCAGGG - Intronic
944663092 2:201937504-201937526 TCACCTTCATCTGCCCATCAGGG - Intergenic
946331883 2:219014113-219014135 AAGCCTCCACCTGCCCATCAGGG - Intronic
948610062 2:239161356-239161378 TTGCCTCCCCCTCCCCATCAAGG + Intronic
1171405848 20:24911979-24912001 CGGCCCCCACCTTCCCATCATGG - Intergenic
1175453661 20:59093142-59093164 TCGCTTCCACCTGTCCATCCTGG - Intergenic
1175811838 20:61862446-61862468 TGGACCCCACCTGTCCATCAAGG - Intronic
1175945655 20:62557594-62557616 TCGCTGCCACCTTCGCATGAAGG + Intronic
1177871262 21:26575488-26575510 TCACAGCTACCAGCCCATCAAGG - Intergenic
1179350878 21:40609844-40609866 TCACCACCATCTGCCCATCCTGG - Intronic
1182146368 22:27999156-27999178 CCACAGCCACCTGTCCATCACGG + Exonic
1182349064 22:29688515-29688537 TAGCCGCCACCTGCCCAGTGAGG + Intronic
1182553406 22:31114762-31114784 TCGAGGCCACCTGGCCAACATGG + Intronic
1184513419 22:44946063-44946085 TGGCCTCCACCGGCTCATCAGGG + Intronic
949927602 3:9054213-9054235 TTGCCGCCCCCTTCCCATCATGG - Intronic
954333284 3:49902125-49902147 TTTCCCCTACCTGCCCATCATGG - Intronic
954748556 3:52800824-52800846 TCTCCACCACCTGCCCCACAAGG + Intronic
957567870 3:81908019-81908041 TCACTGCAACCTGCCCCTCATGG + Intergenic
961726317 3:128933299-128933321 GCCCCACCAGCTGCCCATCAGGG + Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
963870505 3:150409617-150409639 CCGCTGCCAGCTGCCCATCTAGG - Exonic
968507102 4:975909-975931 TCCCCGCCGCCTTCCCATCTAGG + Intronic
968869251 4:3233213-3233235 GAGCAGCCACCTGCCCAGCAGGG + Exonic
968933254 4:3595566-3595588 TAGGCTCCACCTGCCCATCCTGG + Intergenic
970425027 4:15938143-15938165 CAGCCCCCACCTGCCCATGATGG + Intronic
970440960 4:16080910-16080932 CCGCAGCCACCCACCCATCAGGG + Intronic
971333353 4:25700684-25700706 TCGACACCACCTGACCAACATGG - Intergenic
975685523 4:76916617-76916639 TCCCCGCCGCCTTCCCATCTAGG + Intergenic
980123922 4:128755208-128755230 GCAATGCCACCTGCCCATCAAGG + Intergenic
984610374 4:181830341-181830363 TCACTGCCACCTCCCCATCCCGG + Intergenic
985688493 5:1294507-1294529 GCGCAGCTACCTGCCCAACACGG - Exonic
986065419 5:4229753-4229775 TCCTGGCCTCCTGCCCATCATGG - Intergenic
993983952 5:94574467-94574489 TCACCGCAACCTCCCCATCCCGG - Intronic
995476724 5:112555543-112555565 TCTGTGCCACCTGGCCATCATGG + Intergenic
1001424269 5:171613191-171613213 TAGCCACCACATGCCCCTCAGGG + Intergenic
1003162892 6:3651177-3651199 TCGGCCCCACTTGCCCAGCAAGG + Intergenic
1005912916 6:30326719-30326741 TCTCAGCCACCTGCCCCTCTGGG + Intronic
1006840549 6:37025708-37025730 ATGCCCCCACCTGCCCACCAAGG + Intronic
1007383989 6:41508341-41508363 TTGCTGACACCTTCCCATCACGG - Intergenic
1012983741 6:105854287-105854309 TCCCGGCCACCTTCCCATCTAGG - Intergenic
1016723692 6:147333447-147333469 TCACCGCAACCTGCGCATCCTGG - Intronic
1017225769 6:152019758-152019780 TTACCGCCACCTGTCCATGATGG + Intronic
1019338067 7:494493-494515 TCCCCTCCTCCTGCCCATCCCGG + Intergenic
1019698360 7:2460431-2460453 TCCACGCCAACTGCCCATCCGGG + Intergenic
1021735257 7:23636426-23636448 TCGCCGCCGCCATCCCATCTAGG + Intronic
1022103631 7:27183583-27183605 CCGCCGCCACCTCCCCACCTCGG - Intronic
1024244723 7:47460532-47460554 TCCAGGCCACCTGCCCATCCTGG - Intronic
1024353771 7:48394110-48394132 TCTCTGCCAACTGCCCTTCAAGG + Intronic
1024678707 7:51661312-51661334 TCGCCATCACCTGAGCATCAAGG - Intergenic
1025260896 7:57416791-57416813 TCGCGGCCCGCTGCCCACCAGGG - Intergenic
1028146968 7:87329577-87329599 TGGCCCCCAACAGCCCATCAGGG - Intergenic
1034698242 7:153074026-153074048 TCACCCACACCTGCCCAGCAAGG - Intergenic
1035345098 7:158192401-158192423 CCGACGCCACCTGCCCTTCCTGG - Exonic
1037758633 8:21727516-21727538 TGGACACCACCTCCCCATCACGG + Intronic
1040545624 8:48396412-48396434 TCGCCGCCACCTGGCCGTGATGG - Intergenic
1042144036 8:65708898-65708920 ACGCCCCCACCTCCCAATCATGG - Intronic
1044717580 8:95114326-95114348 TCACCTCCACCTGCCTGTCAGGG - Intronic
1046211475 8:111081615-111081637 TCGCTGACACCTGCCCATGGAGG - Intergenic
1055629707 9:78211290-78211312 TTCCCTCCATCTGCCCATCAAGG - Intergenic
1056771526 9:89481214-89481236 CCACCGCCACCTGCTCACCAAGG - Intronic
1057347876 9:94267938-94267960 TCACCGCAACCTGCCCCTCCTGG + Intronic
1060481986 9:124021900-124021922 CCGCCCCCACCTGCCCACCCAGG - Intronic
1061009092 9:127944749-127944771 TCGCCCCCACCAGCCCAGCACGG + Intronic
1062558301 9:137127271-137127293 CCGGCACCACCTGCCCACCAAGG + Intergenic
1189332880 X:40153928-40153950 TCCCCGCCCCCTGCCCCCCACGG - Intronic
1192172690 X:68866803-68866825 GAGCCGCCACCTGCCCTACAGGG - Intergenic
1200092461 X:153642350-153642372 TCTCCGCCCCCTGCCCAGGAGGG - Intergenic
1202231814 Y:22666448-22666470 TCACCGCAACCTCCCCATCCTGG + Intergenic
1202311344 Y:23529717-23529739 TCACCGCAACCTCCCCATCCTGG - Intergenic
1202559458 Y:26140877-26140899 TCACCGCAACCTCCCCATCCTGG + Intergenic