ID: 1077130297

View in Genome Browser
Species Human (GRCh38)
Location 11:968649-968671
Sequence ACGGTGCTGGGGCTTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077130285_1077130297 24 Left 1077130285 11:968602-968624 CCAAGGCGGCTTCCAGCGGGTGA 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1077130297 11:968649-968671 ACGGTGCTGGGGCTTCCCAGTGG 0: 1
1: 0
2: 1
3: 25
4: 188
1077130289_1077130297 12 Left 1077130289 11:968614-968636 CCAGCGGGTGATGGAATCTGGGC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1077130297 11:968649-968671 ACGGTGCTGGGGCTTCCCAGTGG 0: 1
1: 0
2: 1
3: 25
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077130297 Original CRISPR ACGGTGCTGGGGCTTCCCAG TGG Intronic