ID: 1077133039

View in Genome Browser
Species Human (GRCh38)
Location 11:984124-984146
Sequence TCACTTGTTCAGGAGGTTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077133039 Original CRISPR TCACTTGTTCAGGAGGTTGA CGG Intronic
900841354 1:5051036-5051058 TGAGTTCTTCAGGAGGGTGAAGG - Intergenic
901327976 1:8380461-8380483 CCAGCTGCTCAGGAGGTTGAGGG - Intronic
901460518 1:9388554-9388576 GCATTTGTTGAGGATGTTGAGGG + Intergenic
902872585 1:19323519-19323541 CCAGCTGTTCAGGAGGCTGAGGG - Intronic
906343225 1:44998853-44998875 TCACTTGGCCTGGAGGTGGAGGG + Intergenic
914848596 1:151297164-151297186 TCACTTGAGCAGGAGGTTAAGGG - Intronic
916790800 1:168123341-168123363 CCAGTTAATCAGGAGGTTGAGGG + Intronic
917633690 1:176915463-176915485 TCAAGTGTTCTGGAGGTTGCTGG - Intronic
921854342 1:219965071-219965093 TCTGTTGATGAGGAGGTTGAGGG - Intergenic
922040480 1:221891465-221891487 TCACTTGTTCTAGGGGATGAAGG - Intergenic
922172345 1:223166330-223166352 TCCCTTGTTCAGGGTGCTGAAGG - Intergenic
923298210 1:232615548-232615570 TCACTTATTCAGGAGCCAGAGGG - Intergenic
923540370 1:234884421-234884443 TCACTTGGGCAGGAGGTGCAAGG + Intergenic
1065136200 10:22672832-22672854 TCACCTTTTTAGGACGTTGAGGG - Intronic
1065219734 10:23484332-23484354 TCAGCTATTCAGGAGGCTGAGGG - Intergenic
1069971174 10:72170888-72170910 TCAGCTGCTCAGGAGGCTGAGGG + Intronic
1069997686 10:72353148-72353170 GCACCAGTTCAGGAGCTTGAAGG - Intronic
1074891115 10:117737378-117737400 TCACATGGCCAGGAGGTTGCAGG + Intergenic
1074920241 10:118001091-118001113 CCACCTATTCAGGAGGCTGAGGG + Intergenic
1075450329 10:122546890-122546912 ACTCTTGCTCAGGAGGCTGAGGG + Intergenic
1077133039 11:984124-984146 TCACTTGTTCAGGAGGTTGACGG + Intronic
1078548988 11:12267570-12267592 TGTTTTGTTGAGGAGGTTGAGGG - Intergenic
1078901037 11:15643087-15643109 TCACTTGTTAAGGTGATTTAGGG - Intergenic
1079508663 11:21184381-21184403 TCAGCTACTCAGGAGGTTGAGGG - Intronic
1079853501 11:25569285-25569307 TGACTTGTTAAGGAGTATGAAGG - Intergenic
1080531578 11:33181464-33181486 TCAGCTATTCAGGAGGCTGAGGG + Intergenic
1082285169 11:50310212-50310234 TATCTTGCTCACGAGGTTGAAGG + Intergenic
1082620506 11:55415768-55415790 TCAGTTACTCAGGAGGCTGAGGG - Intergenic
1083994765 11:66266450-66266472 GCTCTTGTTGAGGAAGTTGAGGG - Exonic
1085184244 11:74561977-74561999 TCAGTTGTTGATGAGGTGGATGG + Intronic
1087246849 11:95849225-95849247 TAACTTGTTCAGGTGGAGGACGG + Intronic
1088796505 11:113270281-113270303 ACACTTGTTCAGGAAGTAGCAGG - Exonic
1089968328 11:122672192-122672214 TGTCTTCTTCAAGAGGTTGAGGG - Intronic
1097346459 12:58498744-58498766 TCTCATGCACAGGAGGTTGAAGG + Intergenic
1098961281 12:76742071-76742093 ACACATGTTCAGCAGGTTTAGGG + Intergenic
1099169885 12:79350596-79350618 TCACATGTTGGGGAGGATGAGGG - Intronic
1102520536 12:113475307-113475329 TCACTTATACAAGATGTTGATGG + Intergenic
1104880327 12:132066471-132066493 TTACTGGTTCAGGAGATGGAGGG + Intronic
1106762324 13:32879457-32879479 CCACTTGTTCTGGAGCCTGAAGG - Intergenic
1108107025 13:47021596-47021618 TAACTTCTTTTGGAGGTTGAGGG + Intergenic
1108139440 13:47403597-47403619 TAACTTGTTCAGGAAAGTGAAGG + Intergenic
1109098724 13:58151097-58151119 TCACTTGTTCTTGAAGTTCAAGG - Intergenic
1109298361 13:60563111-60563133 CCAGTTGCTCAGGAGGCTGAGGG + Intronic
1114821099 14:26020032-26020054 TCACTTGTAAAGCAGGATGATGG - Intergenic
1117162201 14:53000726-53000748 TCAGCTACTCAGGAGGTTGAGGG + Intergenic
1120141944 14:80939461-80939483 TCATTTCTTCATGAGGTTCAGGG + Exonic
1121965066 14:98296267-98296289 GCACTTATTCAGTAGTTTGAAGG + Intergenic
1122160170 14:99777897-99777919 TCAGCTGCTCAGGAGGCTGAAGG - Intronic
1124135648 15:27033679-27033701 TCAGTTGTTTAAGAGGATGATGG + Intronic
1125840964 15:42800963-42800985 TCACTTGGGCAGGACGTTGGAGG + Intronic
1128392570 15:67192487-67192509 ACACATGTACAGGAGGTTCAGGG - Exonic
1129071544 15:72955451-72955473 TTACTTGTCCAGGAAGTTCAGGG - Intergenic
1129560395 15:76560221-76560243 ACCCTTGTGAAGGAGGTTGAAGG + Intronic
1130287095 15:82565142-82565164 TCACTTGTTCTGTGGGTTGAAGG - Intronic
1130924485 15:88375002-88375024 TGACCTGTTCAGGAGTTTGAGGG - Intergenic
1131036248 15:89224225-89224247 TCAGCTGCTCAGGAGGCTGAGGG - Intergenic
1134751640 16:16629906-16629928 TTTCTTGTTCAGGAGGTCGAGGG + Intergenic
1134993819 16:18723703-18723725 TTTCTTGTTCAGGAGGTCGAGGG - Intergenic
1135930826 16:26735039-26735061 TCACTGATGTAGGAGGTTGACGG + Intergenic
1136664647 16:31799219-31799241 GCCCTTGTGAAGGAGGTTGAAGG - Intergenic
1138466031 16:57191166-57191188 ACAATTCTTCAGGAGGTAGAGGG - Intronic
1138508221 16:57489728-57489750 TCAGCTACTCAGGAGGTTGAGGG - Intergenic
1139836205 16:69840594-69840616 ACACTTTTTGGGGAGGTTGAAGG + Intronic
1144325192 17:14172660-14172682 TCACGAGTTCTGGAGGTTAAGGG - Intronic
1144474068 17:15569542-15569564 TCACGAGTTCTGGAGGTTAAGGG - Intronic
1146653599 17:34622282-34622304 TCACTTGTTCTGGAGCTTAAAGG - Intronic
1148546762 17:48525097-48525119 TCTCTTGTTCAGGAGATCAAAGG + Intergenic
1149907546 17:60540025-60540047 CAGCTTGTTCAGGAGGCTGAGGG + Intergenic
1150011271 17:61506400-61506422 TCACCTACTCAGGAGGCTGAGGG + Intergenic
1152610597 17:81313437-81313459 TCACTGTTTCAGGAGGTGGCCGG + Exonic
1152624722 17:81383013-81383035 TCACCTGCACAGGAGGCTGAGGG - Intergenic
1155258741 18:24021397-24021419 TCACTTGTTCAGAAACTGGAAGG - Intronic
1156367950 18:36446955-36446977 TCCCTTGCTGGGGAGGTTGAGGG + Intronic
1157807584 18:50669575-50669597 TTACTGGATCAGGAGTTTGACGG - Intronic
1157825995 18:50813096-50813118 TCACTTGATCTGGAGGTGCATGG + Intronic
1158631477 18:59118837-59118859 TCATTGCTTCAGAAGGTTGAGGG - Intergenic
1162448879 19:10742373-10742395 TCACTAGTTCATGAGGGTGACGG - Intronic
1166161047 19:40953542-40953564 GCACTTGTTCTGGAGGGTGGGGG - Intergenic
926761058 2:16279497-16279519 GCTCTTGTTCCTGAGGTTGAAGG + Intergenic
928212300 2:29332338-29332360 AGATTTGTTCAGGAGGTTGAGGG - Intronic
929656548 2:43737901-43737923 TCACATGTTCAGGAAGGTAAAGG + Intronic
941680331 2:168391491-168391513 TCAGTTGTTCTGGAGGAAGAAGG + Intergenic
942531833 2:176918623-176918645 CCAGTTATTCAGGAGGCTGAGGG + Intergenic
943572905 2:189594945-189594967 TCAGCTATTCAGGAGGCTGAGGG + Intergenic
946243414 2:218370969-218370991 TCAGCTACTCAGGAGGTTGAGGG + Intergenic
947778741 2:232738029-232738051 TCAGCTACTCAGGAGGTTGAGGG - Intronic
948029852 2:234808505-234808527 CCAGTTATTCAGGAGGCTGAGGG - Intergenic
1176310039 21:5144691-5144713 TCACTTGTTCAGGAGGGACGGGG - Intronic
1177529844 21:22344820-22344842 TCACTTGCTGTGGAGCTTGAGGG - Intergenic
1177860315 21:26444879-26444901 CCACCTGTTCCGGTGGTTGAAGG - Intergenic
1179314063 21:40225582-40225604 TCCCTCATCCAGGAGGTTGAGGG + Intronic
1179333418 21:40427389-40427411 TCAATTGTTCAATAGGTTAATGG + Intronic
1179513465 21:41890706-41890728 ACCCATGTTGAGGAGGTTGAAGG + Intronic
1179847017 21:44117341-44117363 TCACTTGTTCAGGAGGGACGGGG + Intronic
1183907133 22:41049965-41049987 TCCCATTTTCAGGAGGTTTAGGG - Intergenic
950679780 3:14576855-14576877 TCAATGGTTCAAGTGGTTGATGG - Intergenic
952121387 3:30248996-30249018 CCACCTGCTCAGGAGGCTGAGGG + Intergenic
953335905 3:42093815-42093837 CCAGCTATTCAGGAGGTTGAGGG - Intronic
957195730 3:77064877-77064899 TCATTTTTTCATAAGGTTGATGG + Intronic
958752623 3:98210603-98210625 TCACTCTGTCAGGAGGTGGAGGG + Intergenic
961790086 3:129369307-129369329 TCACTTTTTCAGGTTGTTGTTGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
965885495 3:173441065-173441087 AGACTGGTTCATGAGGTTGAAGG - Intronic
966308770 3:178569753-178569775 TAACTCTTTCAGAAGGTTGAAGG - Intronic
967888215 3:194347333-194347355 TCACTTCTTCCAGAGGGTGATGG + Intronic
970414102 4:15839536-15839558 CCAGTTATTCAGGAGGCTGAGGG - Intronic
971950553 4:33340154-33340176 TCCCTTATACAGGAGGTTGTAGG - Intergenic
973192131 4:47397679-47397701 TCAGTTACTCAGGAGGCTGAAGG - Intronic
973547536 4:51996504-51996526 CCAGCTGTTCAGGAGGCTGAGGG - Intronic
975272021 4:72446887-72446909 AGACTTGTTAAGGAGGATGAGGG - Intronic
975548464 4:75585476-75585498 TTAGTTACTCAGGAGGTTGATGG + Intronic
976133802 4:81913252-81913274 TCACTTGTTTAAGGGGTTAAGGG + Intronic
978306115 4:107330326-107330348 TCAATTGTTCCTGAGGGTGAGGG - Intergenic
978609539 4:110522294-110522316 TCAGTTACTCAGGAGGCTGAGGG - Intronic
979594284 4:122516534-122516556 CCCCTTGATCAGGAGGGTGAGGG + Intergenic
980234302 4:130085182-130085204 TCACATGTTCAAGAAGTTGAAGG - Intergenic
980504805 4:133703986-133704008 TCACTTGGTTAGGAGTTTGTAGG - Intergenic
981801994 4:148668608-148668630 TCACCAGTTCAGCAGGTTGAGGG - Intergenic
982201394 4:152964466-152964488 TCACCTGTTCAGGAGGTGAGAGG - Intronic
982201900 4:152969782-152969804 TCAGCTGCTCAGGAGGCTGAGGG - Intronic
985278056 4:188258178-188258200 TCCCTTGTTCAGGAGAGTAATGG + Intergenic
986665333 5:10097800-10097822 TCAGTTGCTCAAGAGTTTGAGGG - Intergenic
990543265 5:56795900-56795922 CCAGTTGCTCAGGAGGCTGAGGG + Intergenic
990703098 5:58496877-58496899 GCACCACTTCAGGAGGTTGAAGG - Exonic
992061049 5:73048089-73048111 CCAGTTCTTCAGGAGGCTGAGGG - Intronic
994516671 5:100781127-100781149 TGAATTTTTCAGAAGGTTGATGG + Intergenic
995387116 5:111600315-111600337 TCAATAGTTCAGAAGTTTGATGG + Intergenic
996292770 5:121873379-121873401 TCACTTGTTTAGGTAGGTGATGG + Intergenic
998803027 5:145890202-145890224 CCAGGTATTCAGGAGGTTGAGGG - Intergenic
1007303575 6:40887148-40887170 ACACTTGCTCAGGAAGCTGAAGG + Intergenic
1010807677 6:80258336-80258358 TCACATTTTCAGGGGTTTGAAGG + Intronic
1011267183 6:85534368-85534390 TGTCTTGTTTAGGAAGTTGAGGG - Intronic
1013576482 6:111488309-111488331 TCGCATGTTCATGAAGTTGATGG + Intergenic
1022117057 7:27270442-27270464 TCACTAGCCCAGGAGGTGGAGGG - Intergenic
1022646455 7:32233809-32233831 TCATTTATTCAGTTGGTTGATGG - Intronic
1026010805 7:66634485-66634507 TCAGCTATTCAGGAGGCTGAAGG - Intronic
1029404868 7:100368627-100368649 TCTGTGCTTCAGGAGGTTGAGGG + Intronic
1030090882 7:105857465-105857487 CCAGTTGTCCAGGAGGTGGAAGG - Intronic
1030321955 7:108178756-108178778 TCACTTCCTCATGAGGATGATGG + Intronic
1031895123 7:127339563-127339585 TCTCTTGGTCTGGAAGTTGAGGG - Intergenic
1034488510 7:151380935-151380957 TCACTGGTGCAGGAAGTGGATGG - Intronic
1037519378 8:19665126-19665148 CCACCTACTCAGGAGGTTGATGG - Intronic
1038153802 8:24967795-24967817 TCAGTTACTCAGGAGGCTGAGGG + Intergenic
1038742626 8:30228869-30228891 CCAGCTGTTCAGGAGGCTGAGGG - Intergenic
1040878511 8:52177546-52177568 TAACTTGTTCAGAGGGCTGAAGG + Intronic
1040998992 8:53431046-53431068 TCACTTGTTTTGGAAGGTGAGGG - Intergenic
1043445433 8:80315144-80315166 TCACTAGTTTATGAAGTTGAAGG - Intergenic
1044889515 8:96818242-96818264 TGACTTGTCCGGAAGGTTGATGG - Intronic
1045992882 8:108330486-108330508 TCACTAGCTCAGGTGGTGGAAGG - Intronic
1048366144 8:133740340-133740362 TCTCTTCCTCAGGAGGTTGCAGG - Intergenic
1050661550 9:7888731-7888753 TCCCTTATTCAGGAGGTTTTGGG - Intergenic
1050852792 9:10309169-10309191 TCAATTGTTTAGAAGTTTGAAGG - Intronic
1050996247 9:12221253-12221275 TTAGTTATTCAGGAGGCTGAGGG + Intergenic
1052785117 9:32820994-32821016 TCACTTGTTAACAAGGTTTAGGG - Intergenic
1053472556 9:38357343-38357365 GCAGTTTTTCAGGAGGCTGAAGG + Intergenic
1057953855 9:99391618-99391640 TAACCTGTTCAAGAGGCTGAAGG - Intergenic
1059070431 9:111130175-111130197 TCAGCTATTCAGGAGGTTTAGGG - Intergenic
1060359049 9:122937480-122937502 TCAGCTTTTCAGGAGGCTGAGGG + Intergenic
1061633272 9:131887710-131887732 TTTCTTGTTCATCAGGTTGAAGG - Intronic
1062150005 9:135013303-135013325 TTACCTGTTCAGGAGGGTGCTGG + Intergenic
1186348670 X:8720812-8720834 CCAGTTACTCAGGAGGTTGAGGG + Intronic
1187439486 X:19305230-19305252 TCACCAGTTCAGGAGTTTGAAGG - Intergenic
1188521913 X:31047696-31047718 GGACTTGTTCAGGAAGTTGCTGG - Intergenic
1192679553 X:73237695-73237717 ACACTTGTTCAGGTGGCTGTGGG + Intergenic
1196095978 X:111800410-111800432 TCACGAGGTCAGGAGTTTGAGGG + Intronic
1196118782 X:112025896-112025918 TCACAGGTTCAAGAGGTTGAGGG - Intronic
1197650237 X:129056236-129056258 TTACCTATTCAGGAGGATGAGGG + Intergenic