ID: 1077134780

View in Genome Browser
Species Human (GRCh38)
Location 11:993072-993094
Sequence TGCCACACGCTGACCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077134780_1077134790 30 Left 1077134780 11:993072-993094 CCAGGGCAGGTCAGCGTGTGGCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1077134790 11:993125-993147 CTGAGGGTGCTGAGGAAGGCAGG 0: 1
1: 1
2: 5
3: 82
4: 616
1077134780_1077134784 5 Left 1077134780 11:993072-993094 CCAGGGCAGGTCAGCGTGTGGCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1077134784 11:993100-993122 GGGTTCCTTGCTGCTGACACAGG 0: 1
1: 0
2: 2
3: 16
4: 171
1077134780_1077134788 22 Left 1077134780 11:993072-993094 CCAGGGCAGGTCAGCGTGTGGCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1077134788 11:993117-993139 CACAGGTACTGAGGGTGCTGAGG 0: 1
1: 0
2: 3
3: 293
4: 7982
1077134780_1077134787 14 Left 1077134780 11:993072-993094 CCAGGGCAGGTCAGCGTGTGGCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1077134787 11:993109-993131 GCTGCTGACACAGGTACTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 169
1077134780_1077134789 26 Left 1077134780 11:993072-993094 CCAGGGCAGGTCAGCGTGTGGCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1077134789 11:993121-993143 GGTACTGAGGGTGCTGAGGAAGG 0: 1
1: 0
2: 4
3: 314
4: 8278
1077134780_1077134786 13 Left 1077134780 11:993072-993094 CCAGGGCAGGTCAGCGTGTGGCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1077134786 11:993108-993130 TGCTGCTGACACAGGTACTGAGG 0: 1
1: 0
2: 2
3: 23
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077134780 Original CRISPR TGCCACACGCTGACCTGCCC TGG (reversed) Intronic
900541711 1:3206203-3206225 TGGCCCACACTGACCTGGCCAGG + Intronic
900580979 1:3409010-3409032 TCACACACACTGACATGCCCCGG - Intronic
900610658 1:3543274-3543296 TGGCACACACTGCCCTGCCAGGG + Intronic
900701791 1:4053207-4053229 TTCCACACGCTGAACTTCTCTGG + Intergenic
901492732 1:9604756-9604778 TGCCACATTCAGCCCTGCCCAGG + Intronic
901756373 1:11443911-11443933 TGCTCCCCGCTGCCCTGCCCAGG - Intergenic
902195189 1:14793053-14793075 TGCCACACACACACCTGCCTGGG - Intronic
902341157 1:15784513-15784535 AGACACATGCTGACCCGCCCTGG - Intronic
903015484 1:20358838-20358860 TGCCACACACACCCCTGCCCTGG - Intergenic
903048999 1:20587144-20587166 TGCCCCACCCAGCCCTGCCCAGG - Intergenic
904466040 1:30708037-30708059 TGCCTCACTCTGAGATGCCCTGG - Intergenic
906142309 1:43540966-43540988 TGCCACGCGGTGAACTGTCCAGG + Intronic
907423403 1:54362780-54362802 AGCCACACGCTAGACTGCCCTGG + Intronic
908480650 1:64535785-64535807 TTACACATGCTGACCTCCCCTGG + Intronic
908615686 1:65919755-65919777 TGCCACATGCTGAGCTCTCCAGG + Intronic
909841916 1:80338052-80338074 CGCCACCCGTTGACATGCCCTGG - Intergenic
910653840 1:89599923-89599945 TACCACACACTTACCTGCCCAGG - Intergenic
912188099 1:107304890-107304912 TGCCACCCCCTGACAGGCCCTGG + Intronic
912625972 1:111204547-111204569 CACCCCACGCTGCCCTGCCCAGG - Intronic
912815768 1:112826798-112826820 TGCCACACGCTGCTCTGGCGAGG - Intergenic
920323370 1:205141934-205141956 TGCTGCACGCTGACCTTCCCTGG + Intergenic
922100744 1:222475398-222475420 TGCCTCACGGTGGCCTCCCCAGG - Intergenic
922212131 1:223494524-223494546 TTCCACACACTGGCCTGCTCAGG + Intergenic
922252637 1:223864041-223864063 TGCCACATGATTACATGCCCAGG + Intergenic
922733880 1:227969277-227969299 TGCCTCACGGTGGCCTCCCCAGG + Intergenic
922799904 1:228360426-228360448 TGCCCCACGCTGAGCAGCACAGG - Intronic
923007078 1:230058519-230058541 TGCTACTCGCTGAGCTGCCTTGG + Intronic
1063546429 10:6986402-6986424 TGCCCCACTCTGATCTGCCTGGG + Intergenic
1063639743 10:7818144-7818166 CGCCAAACGCAGACCTGCGCTGG - Intergenic
1064207495 10:13336332-13336354 TGGCACACGCTATCCTGCCCTGG + Exonic
1067082550 10:43219712-43219734 GGCCACACACAGACCTGTCCCGG + Intronic
1067707799 10:48623730-48623752 TGCCAACCCCAGACCTGCCCTGG - Intronic
1068842731 10:61633335-61633357 TTCCACATGATGACCTGTCCTGG - Intergenic
1070565207 10:77598783-77598805 AGCCACAGCCTGACCTTCCCAGG - Intronic
1070570970 10:77638796-77638818 TTCCACAGGCTGAGCTCCCCAGG + Intergenic
1073179382 10:101574649-101574671 GGCCACACGGTCACATGCCCAGG + Intronic
1073213740 10:101825151-101825173 TGCCTCATGGTGACCTGCGCTGG + Intergenic
1075389680 10:122083522-122083544 TGCCGCACGCAGAGCTGCCCTGG + Exonic
1076413865 10:130271164-130271186 TGCCACACTCTTCCCTGCCAGGG - Intergenic
1077134780 11:993072-993094 TGCCACACGCTGACCTGCCCTGG - Intronic
1082004150 11:47410418-47410440 TCCCACACCCTGGCCAGCCCTGG - Intronic
1082131989 11:48501610-48501632 TGCCATACACTGAGCTGCACTGG + Intergenic
1082260819 11:50075274-50075296 TGCCTCACGGTGACCTCCCCAGG - Intergenic
1082565445 11:54672221-54672243 TGCCATACACTGAGCTGCACTGG + Intergenic
1084573945 11:69976810-69976832 TGCCAGGCCCTGACCGGCCCGGG + Intergenic
1084627846 11:70322468-70322490 TCCCGCACGCTGCCCAGCCCAGG + Intronic
1084814685 11:71639312-71639334 TGCGCCGCGCTCACCTGCCCTGG - Intergenic
1087263156 11:96033244-96033266 TTCCAAACCCTTACCTGCCCTGG + Intronic
1087675097 11:101152535-101152557 TCCCACCCGCTGACAGGCCCTGG + Intergenic
1088886499 11:114011636-114011658 TGCCACACCCTTTCCTGCCTCGG + Intergenic
1090604405 11:128406565-128406587 TGCAAACTGCTGACCTGCCCAGG + Intergenic
1093879115 12:24383541-24383563 TGTCCCACTCTGTCCTGCCCAGG + Intergenic
1094486023 12:30926660-30926682 GCCCACACGCTGACCTTCCCGGG + Intronic
1096497248 12:52045735-52045757 GGCCACTAGCTGACCTGCCTGGG + Intronic
1097187561 12:57203906-57203928 TGTCCCTCGCTGACCTGCCTGGG + Intronic
1097631625 12:62071278-62071300 AGCCACATGCTGACCTTCCCGGG - Intronic
1098016623 12:66111551-66111573 TGACACACACTGACCGGCCCTGG - Intergenic
1102801183 12:115735698-115735720 TCCCACCCGCTGACAGGCCCTGG - Intergenic
1103913758 12:124365572-124365594 TGCCACACGCTCAGCTGAGCGGG + Intronic
1104015899 12:124961996-124962018 TGTCACACACAGCCCTGCCCTGG - Intronic
1104598900 12:130139279-130139301 TGCCACACACTGACGTTCTCCGG + Intergenic
1104858139 12:131911440-131911462 TGGCATCCGCAGACCTGCCCTGG + Intronic
1107730980 13:43348601-43348623 TGTCTCACTCTGACCTGACCGGG + Intronic
1107815074 13:44237456-44237478 TGAGACAGGCTGTCCTGCCCAGG + Intergenic
1108050077 13:46426491-46426513 TGCCCCACTCTGTCCTGCCCAGG + Intronic
1109542599 13:63799800-63799822 TGTCCCACTCTGTCCTGCCCAGG + Intergenic
1110253830 13:73409886-73409908 TGCCACACTCTGTCATCCCCAGG - Intergenic
1110800013 13:79683829-79683851 TGCCACAGCCTGAACTGCCCTGG - Intergenic
1110872424 13:80467997-80468019 TGCCACCCCCTGACATGCCCTGG - Intergenic
1117042483 14:51779546-51779568 TGCCACACTCTGCCCTTCACAGG + Intergenic
1119784952 14:77306074-77306096 TGTCACCTGCTGCCCTGCCCCGG - Intronic
1121122782 14:91386537-91386559 TGCCACACACACACCTGCCACGG + Intronic
1122100993 14:99409374-99409396 TGCCACCCGCTCCCCTCCCCTGG - Intronic
1122101828 14:99418563-99418585 TGCCACAGGCTGTCCTGCCCAGG - Intronic
1122930958 14:104932935-104932957 TGCCAAACGCAGTCCTGGCCCGG - Exonic
1125747219 15:42005178-42005200 CTCCACACCCTGACCTCCCCTGG - Intronic
1129391530 15:75223350-75223372 TCCTACACCCTGCCCTGCCCTGG + Intergenic
1129472773 15:75764504-75764526 TCCTACACCCTGCCCTGCCCTGG - Intergenic
1131556148 15:93401162-93401184 CCCCACCCACTGACCTGCCCTGG + Intergenic
1132317027 15:100897777-100897799 TGCCACCCGCTAACCTGTCCTGG - Intronic
1132845861 16:2000502-2000524 CCCCACACCCTGACCTGACCTGG - Intronic
1135865551 16:26098571-26098593 TGCCACCCCCTGACAGGCCCTGG - Intronic
1137041875 16:35620712-35620734 TGCCACACACTGCTCTGGCCAGG + Intergenic
1141556544 16:84840186-84840208 TGCCACAGGCTGAGCTGGCCTGG + Intronic
1141925507 16:87166186-87166208 TGCCACAGCCTGACCAGCTCTGG + Intronic
1144417000 17:15057822-15057844 TGTCACCCCCTGACCAGCCCCGG - Intergenic
1144849267 17:18235812-18235834 TGGCCCACGCTGAGCTGCCCAGG + Intronic
1144957914 17:19028830-19028852 TGCCACGTGCTAACCAGCCCAGG + Intronic
1144977244 17:19145690-19145712 TGCCACGTGCTAACCAGCCCAGG - Intronic
1145266215 17:21380756-21380778 AGCAACTCGCTGCCCTGCCCTGG - Intronic
1147569720 17:41561708-41561730 TGCCCCACTCTGTCCAGCCCAGG + Intergenic
1151948336 17:77331517-77331539 TGCCACCCGCCTCCCTGCCCAGG - Intronic
1152621279 17:81366125-81366147 TGCCACAGCCAGGCCTGCCCTGG + Intergenic
1152760038 17:82103027-82103049 GGCCGCCCGCTGACCTGCCTGGG - Intronic
1154980683 18:21500107-21500129 TGCCCCACGCCGACGTGGCCTGG + Exonic
1156424482 18:36995111-36995133 TCCCACCCGCTGACAGGCCCCGG + Intronic
1158291626 18:55951017-55951039 TGCCACACGCTGCTCTGGCGAGG - Intergenic
1159946606 18:74448531-74448553 TGCCACATCCTTACCTGCTCTGG + Intronic
1160390473 18:78527616-78527638 GGCCACACGGTGTCCAGCCCAGG + Intergenic
1160581241 18:79885686-79885708 TGCAACCCAGTGACCTGCCCAGG + Intronic
1161101503 19:2424157-2424179 AGCCACAGGCTCACCTGCCACGG - Exonic
1161346870 19:3772483-3772505 TGCCACACTAGGACCTACCCTGG + Intergenic
1161352473 19:3801654-3801676 TGCCACCCGCCGGCCTGCTCCGG + Exonic
1162032066 19:7921787-7921809 TGGGACACCCTGACCTGCCTGGG - Intronic
1163250168 19:16122189-16122211 TTCCAGGAGCTGACCTGCCCTGG + Intronic
1165040149 19:33063324-33063346 TGCCCCACACTGTCCTGCCCAGG + Intronic
1166071325 19:40389914-40389936 TGCCAGACACCGCCCTGCCCAGG + Exonic
1166821890 19:45585551-45585573 TGCCACCCCCTGCCCTGCTCTGG - Intronic
1167077685 19:47259234-47259256 TGGCCCCTGCTGACCTGCCCAGG - Intronic
1167098589 19:47390030-47390052 AGCCACACACTGACCATCCCTGG + Intergenic
1167318790 19:48782578-48782600 TGCCTCTCGCTGACCTGCTTCGG - Intergenic
1167393376 19:49211240-49211262 CGCCACCCCCTGACCTGCCTGGG + Exonic
1168257794 19:55176065-55176087 TGCCACCTGCTGCCCTGGCCCGG + Exonic
1168317299 19:55489873-55489895 AGCCACACGCTGACCTGCGGCGG - Exonic
925419863 2:3703445-3703467 TGCCGCCTGCTCACCTGCCCGGG + Intergenic
927129477 2:20046186-20046208 CGCCACCCGCTGACAGGCCCTGG - Intronic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
931781460 2:65582457-65582479 AGTCACATGCTTACCTGCCCAGG + Intergenic
934322830 2:91983425-91983447 TGCCACTCTTTGCCCTGCCCTGG + Intergenic
938772576 2:134512945-134512967 TGCCACATCCTCACCTGGCCTGG - Intronic
939588946 2:144039785-144039807 TCCAACACACTGACCAGCCCTGG + Intronic
947743386 2:232495295-232495317 TTCCTCACACTGACCAGCCCGGG + Intergenic
948425841 2:237886156-237886178 TGCCCCACTCTGCCCAGCCCTGG - Intronic
948771013 2:240251277-240251299 TGACTCACGCTGGGCTGCCCGGG + Intergenic
948846576 2:240685699-240685721 TGCCAGAGGCTGAGGTGCCCAGG - Intergenic
948847285 2:240689035-240689057 TGCCAGAGGCTGAGGTGCCCAGG + Intergenic
948980565 2:241492295-241492317 TGCTGCACCCTGACCTACCCAGG - Intronic
1170732672 20:18988240-18988262 TGCTACATGCTGACCAGGCCCGG + Intergenic
1171480759 20:25454224-25454246 TTCCACACTCTGACCGTCCCAGG - Intronic
1173062839 20:39678821-39678843 TGGCACACACTGGCATGCCCAGG + Intergenic
1175919829 20:62445642-62445664 CGCCTTACGCTGAGCTGCCCAGG + Intergenic
1176082683 20:63281893-63281915 TGCCCCGCGCTGCCCTGCTCTGG - Intronic
1176604775 21:8820004-8820026 TGCCAGACCCTGCCCTGGCCCGG - Intergenic
1176866371 21:14057003-14057025 TGCTCCACCCTGCCCTGCCCTGG - Intergenic
1177355378 21:19999533-19999555 TGCCACACGCTGCTCTGGCGAGG + Intergenic
1179503031 21:41821708-41821730 TGACACAGGCTGGCCTTCCCAGG + Intronic
1180109441 21:45641262-45641284 TGACACACGCTGATCCGGCCTGG - Intergenic
1180347065 22:11711609-11711631 TGCCAGACCCTGCCCTGGCCCGG - Intergenic
1184042632 22:41953040-41953062 TCCTACACGCTCCCCTGCCCTGG + Intergenic
1184229862 22:43152549-43152571 TGCCTCAGGCTGCCCTGTCCCGG - Intronic
1184243968 22:43226703-43226725 CGCCACACTCTGACATCCCCAGG - Intronic
1185247219 22:49779626-49779648 AGCCACACGCTGAGCTGCCCTGG + Intronic
1185366249 22:50438260-50438282 TGACACTCGCTGTGCTGCCCGGG + Exonic
954278019 3:49554818-49554840 AGACACGCGCTTACCTGCCCGGG - Exonic
955333813 3:58068889-58068911 TGCCCCATGCTCACCTGGCCTGG - Intronic
955364070 3:58297043-58297065 TGCCACACACTGGCCTGGTCTGG - Intergenic
955589718 3:60522020-60522042 TGCCACCCTCTGACCTACACAGG - Intronic
961239824 3:125400955-125400977 GTCCCCACGCTGACCTGGCCAGG + Intergenic
961646477 3:128395355-128395377 TGCCTCACTGAGACCTGCCCAGG + Intronic
962276776 3:134020502-134020524 TGCCACACACTGCCCTGGCAAGG - Intronic
966525148 3:180912327-180912349 TGCCACAGAATGAACTGCCCAGG - Exonic
968427929 4:535443-535465 TCCCAGACGCTCGCCTGCCCGGG - Intronic
969371356 4:6733393-6733415 TGCCACTCACTGAACTCCCCTGG - Intergenic
969737345 4:9000603-9000625 TGCGCCTCGCTCACCTGCCCCGG - Intergenic
971358130 4:25913333-25913355 TGCCTGACTATGACCTGCCCAGG - Intronic
979258839 4:118631055-118631077 TGCCTCACGGTGACCTCTCCAGG + Intergenic
979259046 4:118632177-118632199 TGCCTCACGGTGGCCTCCCCAGG + Intergenic
979329303 4:119408382-119408404 TGCCTCACGGTGGCCTCCCCAGG - Intergenic
980085201 4:128383477-128383499 TGCCTCAAGCGGTCCTGCCCTGG - Intergenic
981677168 4:147355441-147355463 TGCCAGATGCTGACTTGCCCAGG - Intergenic
985649625 5:1101361-1101383 TGCCCCAAGCAGACGTGCCCGGG + Intronic
986560309 5:9054086-9054108 TGCAACACGCAGCCCTGCCCAGG - Exonic
989823667 5:45827555-45827577 TGCTTCACGCTGACCTCCACCGG + Intergenic
996171539 5:120298387-120298409 TGCCACACTTTGACCTGAGCTGG - Intergenic
997075837 5:130675587-130675609 TCCCACCCGCTGACAGGCCCTGG - Intergenic
997337465 5:133118373-133118395 TCCCACAGCCTGACCTGCCCTGG + Intergenic
997889069 5:137659070-137659092 TGCCACACAGTGATCTGACCTGG - Intronic
998983847 5:147733618-147733640 TCCCACCCGCTGACAGGCCCCGG + Intronic
999280583 5:150362759-150362781 TTCCTCACCCTGACTTGCCCAGG + Intronic
999445321 5:151634134-151634156 TGCCCCGCCCTGCCCTGCCCAGG + Intergenic
999730541 5:154473820-154473842 TGCCCCACGAGGCCCTGCCCCGG + Intergenic
1004317882 6:14606528-14606550 TGCCACACTGTGAGCTGCCTAGG - Intergenic
1007174688 6:39887796-39887818 TGCCAGACGCTGACCAGGCTGGG - Intronic
1007415214 6:41687666-41687688 AGCCACTCCCTGACCTGCACTGG - Intronic
1010474108 6:76264967-76264989 TGCCAGACCCTGTCCTGCCTTGG + Intergenic
1014091902 6:117413592-117413614 TGTCTCACACTGCCCTGCCCAGG - Intronic
1015485394 6:133764295-133764317 TGCCACAGGCTGGCCTGAGCTGG - Intergenic
1019347767 7:539085-539107 TGCCACACAGTCACCTCCCCAGG + Intergenic
1023028670 7:36074482-36074504 TGCCACAGGCTGACAGGGCCTGG - Intergenic
1023346846 7:39279280-39279302 TGCCACCTGCCGACCTTCCCAGG + Intronic
1024073955 7:45809223-45809245 TGCCTCACGGTGGCCTCCCCAGG + Intergenic
1024933708 7:54690799-54690821 AGCCACGCGCTGGGCTGCCCTGG + Intergenic
1025053456 7:55746304-55746326 TGCCTCACGGTGGCCTCCCCAGG - Intergenic
1025131557 7:56376778-56376800 TGCCTCACGGTGGCCTCCCCAGG - Intergenic
1025182360 7:56829844-56829866 TGCCTCACGGTGGCCTCCCCAGG - Intergenic
1025689567 7:63747150-63747172 TGCCTCACGGTGGCCTCCCCAGG + Intergenic
1027197049 7:76037810-76037832 TGGCTCAAGCTGACCAGCCCAGG + Intronic
1027202369 7:76072094-76072116 TGCCTCACGGTGGCCTTCCCCGG - Intergenic
1027261466 7:76467906-76467928 TGAAACATCCTGACCTGCCCTGG + Intronic
1027312849 7:76966015-76966037 TGAAACATCCTGACCTGCCCTGG + Intergenic
1031756836 7:125654879-125654901 TACCACACCCTGACAGGCCCCGG + Intergenic
1032075517 7:128833980-128834002 TGCCCCACTCCCACCTGCCCCGG - Intronic
1032255352 7:130292708-130292730 TTCCTCATCCTGACCTGCCCTGG + Intergenic
1034271644 7:149806037-149806059 TGCAACACGCAGCCCTGCACAGG + Intergenic
1034273038 7:149812415-149812437 TGCCAGGCTCTGCCCTGCCCAGG + Intergenic
1035652413 8:1278112-1278134 TGCCACTCCCTCACCTGACCTGG - Intergenic
1042175708 8:66035523-66035545 TGTCACATGCTGTTCTGCCCTGG - Intronic
1047498711 8:125426771-125426793 TGCCACAGGTTGAACTCCCCAGG + Intergenic
1049610592 8:143553102-143553124 TGCCAGACACTGTCCTGGCCTGG - Intergenic
1049615019 8:143572305-143572327 TGTTTCACGCTGACCTCCCCCGG + Intronic
1053069884 9:35095041-35095063 TGGCCCACACTGACCTGCACTGG + Exonic
1054773336 9:69103543-69103565 TACCACACCTTCACCTGCCCTGG + Intergenic
1057793991 9:98142868-98142890 TGCCCTGCGCTGCCCTGCCCTGG + Intronic
1058650931 9:107175195-107175217 TTCCACACCCAAACCTGCCCTGG + Intergenic
1060237039 9:121871805-121871827 TGCCACTCACTGGCCTGCCCTGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1186078727 X:5907809-5907831 TGCTGCATGCTGACCTGACCAGG + Intronic
1192368316 X:70493556-70493578 GGCCACACGTGGCCCTGCCCAGG - Intronic
1197378326 X:125709514-125709536 TGCCTCGAGCTGACATGCCCAGG - Intergenic
1198224305 X:134631391-134631413 TGCTCCAAGCTGACCAGCCCTGG + Intronic
1198969469 X:142265796-142265818 TGCCACACGCTGCTCTGGCGAGG - Intergenic