ID: 1077135391

View in Genome Browser
Species Human (GRCh38)
Location 11:995599-995621
Sequence GGTCCCCGCCAAGGAGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077135391_1077135393 -7 Left 1077135391 11:995599-995621 CCTGGCACTCCTTGGCGGGGACC 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1077135393 11:995615-995637 GGGGACCTGCTTATGTGCCCCGG 0: 1
1: 0
2: 1
3: 8
4: 148
1077135391_1077135398 18 Left 1077135391 11:995599-995621 CCTGGCACTCCTTGGCGGGGACC 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1077135398 11:995640-995662 GACCATGTGTCCTGCCCCTCTGG 0: 1
1: 0
2: 1
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077135391 Original CRISPR GGTCCCCGCCAAGGAGTGCC AGG (reversed) Intronic
901391491 1:8949159-8949181 GGTCCCCGCCCAGCAGGCCCTGG + Intronic
902798070 1:18812312-18812334 GGTCCCAGCCTGGGAGTGTCAGG + Intergenic
904697433 1:32338142-32338164 CATCCCCGCCAGGCAGTGCCTGG - Intergenic
905257526 1:36694521-36694543 GGTCCCAGCCAAGTGGAGCCCGG + Intergenic
905901850 1:41586479-41586501 GGGCCTCGCCAAGGGATGCCAGG - Intronic
907414711 1:54306210-54306232 GGTCCCTCCCAAGGAGTGAGTGG + Intronic
912435313 1:109657151-109657173 GGTCCCCGGGAAGGAGGGCTGGG + Intronic
912439713 1:109688609-109688631 GGTCCCCGGGAAGGAGGGCTGGG + Intronic
912443025 1:109713058-109713080 GGTCCCCGGGAAGGAGGGCTGGG + Intronic
918342325 1:183578151-183578173 GGGCCCCTCCAAGCTGTGCCAGG - Intronic
921702979 1:218288178-218288200 GGTGACTGCCAAAGAGTGCCAGG + Intronic
923787470 1:237081886-237081908 GATCATCGCCAAGTAGTGCCTGG - Intronic
1062993335 10:1841349-1841371 GGTTCACGCCAGGGAGTGCATGG - Intergenic
1066254240 10:33663133-33663155 GGTCAGAGCCAAGGATTGCCCGG - Intergenic
1070962919 10:80511540-80511562 GCTCCCTGCTAAGGAGGGCCAGG + Intronic
1074113232 10:110437351-110437373 GGTGCCCTCCCAGGAATGCCTGG + Intergenic
1077135391 11:995599-995621 GGTCCCCGCCAAGGAGTGCCAGG - Intronic
1078665285 11:13319842-13319864 GGGCCCTGCCAGGGAGTGCCAGG + Intronic
1079372624 11:19864579-19864601 TTTCCCCACCAAGGAGAGCCAGG - Intronic
1080834483 11:35927765-35927787 GGCCCCTGCCAAGGAGGGCCGGG - Intergenic
1082784717 11:57310538-57310560 GGGACCAGCCAAGGAGTCCCTGG + Exonic
1083941178 11:65896758-65896780 CGACCCCGCCCAGGAGTGCTAGG - Intronic
1085394617 11:76201041-76201063 GGTCCCAGCCTAGGAGACCCAGG - Intronic
1088401201 11:109423623-109423645 GCCCCGCGCCAATGAGTGCCAGG + Exonic
1088457656 11:110049860-110049882 GCCCTCCGCCAAGTAGTGCCTGG + Intergenic
1091829916 12:3542292-3542314 GGTCCTGGCCCAGGAGGGCCTGG + Intronic
1096098920 12:48957197-48957219 GCCCCACGCCAAGCAGTGCCGGG + Intronic
1112443561 13:99443687-99443709 GGGCTCCCCCTAGGAGTGCCTGG - Intergenic
1114405636 14:22453555-22453577 GGTCTCTGCCACGAAGTGCCAGG + Intergenic
1121868163 14:97381831-97381853 TGTCCAAGCCAAGGAATGCCTGG - Intergenic
1133225924 16:4340381-4340403 GGTCCGCGCAAAGGAGCGCCTGG - Exonic
1134080747 16:11323407-11323429 GTTCCAAGCCAAGGAATGCCTGG + Intronic
1134606844 16:15578049-15578071 TTTCCCCCCCAAGGAATGCCAGG - Intronic
1139650776 16:68361124-68361146 TGTCCCCTCCATCGAGTGCCCGG - Exonic
1139691868 16:68646320-68646342 GGCCCCAGCCCAGGTGTGCCAGG - Intronic
1139695669 16:68672662-68672684 CATCCCCGCCGAGGAGTGCTGGG - Intronic
1140478380 16:75250217-75250239 GCTCCCGGGCAAGCAGTGCCAGG + Intronic
1141174076 16:81707930-81707952 GGCCCCGGCCAAGGGCTGCCGGG - Intronic
1141997707 16:87645795-87645817 GGTCCCCGCCAAGCTGTGGCTGG + Intronic
1142267310 16:89070621-89070643 GGATCCCTCCAAGGTGTGCCAGG + Intergenic
1142412797 16:89924757-89924779 TGTGCCTGCCAAGGAGAGCCTGG + Intronic
1143323010 17:6080301-6080323 TGTCCCAGCCTGGGAGTGCCAGG + Intronic
1144657119 17:17043675-17043697 GGCCCCCGCCCTGGAGTGACTGG + Intronic
1148813000 17:50306678-50306700 GGTCCCAGCTCAGGAGTCCCGGG + Intergenic
1151432395 17:74072318-74072340 GCCCCAAGCCAAGGAGTGCCTGG - Intergenic
1151518822 17:74614225-74614247 AGTCCCCTCCAATAAGTGCCAGG + Intronic
1151812407 17:76452515-76452537 GGTCCCGGGCCAGCAGTGCCTGG + Intronic
1152261387 17:79269188-79269210 TGTCCCCGCCAAGTAATGCCCGG + Intronic
1152332046 17:79679026-79679048 GGTCCCAGCCAAGCGGTCCCCGG - Intergenic
1152665353 17:81565461-81565483 GGCCCCAGCCACGGGGTGCCGGG + Intronic
1157706716 18:49813614-49813636 GGACCCCGCCAAGGAGCCCCAGG - Exonic
1158953537 18:62519708-62519730 GGTCCCTTCCAAGGAGACCCAGG - Intergenic
1160765801 19:807119-807141 GGCCCCCGCGAGGGAGGGCCAGG - Intronic
1161038534 19:2098182-2098204 AGCCCCCTCCAAGGAGAGCCTGG - Intronic
1161398965 19:4059251-4059273 GGTCCCCGCTCTGGAGTGGCTGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162966780 19:14159957-14159979 CCTCTCCGCCAAGGACTGCCGGG - Intronic
1162988006 19:14284134-14284156 GGTCGCCACCGAGGAATGCCTGG - Intergenic
1164708587 19:30338727-30338749 GGACCCCACCAAGGAGGGGCTGG + Intronic
1165657953 19:37550161-37550183 CGTCCCCGCCAAGGTGGTCCTGG - Intergenic
1165922478 19:39307674-39307696 GGGCTCCGCCAGGGCGTGCCTGG - Exonic
1167538292 19:50069401-50069423 GGTACCAGCCAAGAAATGCCAGG + Intergenic
1168171023 19:54589008-54589030 GCCCCAAGCCAAGGAGTGCCTGG - Intronic
929535917 2:42784028-42784050 GGTGCATGCCATGGAGTGCCGGG + Intronic
930177533 2:48315328-48315350 GGGCCCCGCCAAGTAGTGCACGG + Intronic
935165126 2:100563266-100563288 CGTCCCCGCCTCGGTGTGCCGGG + Intronic
936152679 2:110030238-110030260 GGTCCCTGCCAGGGTGCGCCTGG - Intergenic
936162447 2:110094789-110094811 AGTCCCAGCCAAGGTCTGCCTGG + Intronic
936182213 2:110276577-110276599 AGTCCCAGCCAAGGTCTGCCTGG - Intergenic
938900964 2:135798200-135798222 CGTCCCCGCTCAGAAGTGCCTGG + Intronic
946396999 2:219448240-219448262 GGTGCCCGCCAGGGAGGGCCCGG - Exonic
948176362 2:235946664-235946686 GGGCCCCTCCAAGGAGAGGCTGG + Intronic
1168892610 20:1304807-1304829 TGTCACCGCCAAGGAGAGGCAGG - Intronic
1175349593 20:58309114-58309136 TGGTCCCGACAAGGAGTGCCTGG + Intergenic
1178305173 21:31485269-31485291 GGTCCCCAGAAAGGAGTCCCAGG + Intronic
1178911830 21:36680924-36680946 AGCCACGGCCAAGGAGTGCCTGG + Intergenic
1181027017 22:20132304-20132326 GCTCCCCGCCAGGGCCTGCCTGG - Intronic
1183706555 22:39478198-39478220 GGTCCACCCCAAGGTGTACCAGG + Intronic
1185334587 22:50265904-50265926 GGACCCCAGCAAGCAGTGCCTGG - Intronic
951379734 3:21968719-21968741 GGTCCACGGCAAGTACTGCCTGG - Intronic
952522883 3:34179731-34179753 GCTACCAGCCAAGGAATGCCAGG + Intergenic
954003670 3:47576986-47577008 AGGCCCCGCCCAGGAGAGCCAGG - Exonic
967828270 3:193896345-193896367 GGTCACCGCCAAATAGTCCCAGG + Intergenic
975683204 4:76896722-76896744 GTTCCCCGCCCAGGATTCCCAGG + Exonic
982068541 4:151675195-151675217 GCTCCCCGAGAAGGAGGGCCAGG + Intronic
984706526 4:182851147-182851169 GCTCTCCGTCAAGGAGTGCAGGG - Intergenic
985764420 5:1769265-1769287 GGTCGTCGCCAGGGAGCGCCAGG - Intergenic
986572125 5:9176467-9176489 GGACCCAGCTAAGCAGTGCCTGG + Intronic
999265835 5:150266279-150266301 GGTCCCAGCCCAGGATTGCTTGG - Intronic
1001250149 5:170140859-170140881 GCTCCAGGCCCAGGAGTGCCAGG - Intergenic
1002577137 5:180180556-180180578 GGTCCCTGCCCAGAGGTGCCAGG + Intronic
1003369309 6:5509274-5509296 GCTCCACGCCAAGGAATGCTGGG - Intronic
1006535593 6:34696591-34696613 GGTCCCCGCCATGGAGGGCATGG - Exonic
1007732436 6:43955216-43955238 GACCCCACCCAAGGAGTGCCAGG + Intergenic
1016914608 6:149233114-149233136 TGTCCCCACCCATGAGTGCCTGG - Intronic
1018723446 6:166591595-166591617 GGAGGCAGCCAAGGAGTGCCTGG + Intronic
1019473588 7:1233527-1233549 GGACCCGGACAAGGAGAGCCCGG + Exonic
1020014447 7:4822677-4822699 CGTCCCCGCCCAGCAGTGTCAGG - Intronic
1029193939 7:98791278-98791300 GGTGCCAGCCCAGGAGTGCCTGG + Intergenic
1033210135 7:139454167-139454189 GGCCCCCACCCAGGAGTGCCTGG + Exonic
1035868085 8:3106592-3106614 GGTCCCCACCAAGGTGTACCCGG + Exonic
1040537219 8:48320853-48320875 GGTTTCTGCAAAGGAGTGCCAGG + Intergenic
1045638664 8:104223270-104223292 GGTCCCCGCCAATCAGCGGCCGG - Intronic
1047870248 8:129074510-129074532 GGTCACTACCAAGGTGTGCCTGG + Intergenic
1049720151 8:144111906-144111928 GGTCCCAGCAGTGGAGTGCCGGG + Exonic
1052647371 9:31254035-31254057 GGCCGCCGCCAAGCAGTGCAAGG + Intergenic
1058752464 9:108052584-108052606 AGTCCCTGCTAAGGAGTGACAGG + Intergenic
1061878143 9:133555095-133555117 GGTCACAGCCAAGGGGCGCCTGG - Intronic
1062105080 9:134750834-134750856 GGTCTCAGCCCAGGAGTCCCAGG + Exonic
1062275403 9:135728123-135728145 GGCCACCGCCGAGGGGTGCCTGG + Intronic
1062721580 9:138047054-138047076 GGTCCCCGCCAGGCTGTGGCGGG + Intronic
1192326405 X:70135795-70135817 GGTCCACATCAAGGAGAGCCTGG + Intronic