ID: 1077135681

View in Genome Browser
Species Human (GRCh38)
Location 11:997087-997109
Sequence GCCACCCTGAGGCCCCTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077135681_1077135683 12 Left 1077135681 11:997087-997109 CCGTGAAGGGGCCTCAGGGTGGC 0: 1
1: 0
2: 3
3: 18
4: 253
Right 1077135683 11:997122-997144 GCCTTTCCCACGAGAGACAGTGG 0: 1
1: 0
2: 1
3: 10
4: 117
1077135681_1077135687 23 Left 1077135681 11:997087-997109 CCGTGAAGGGGCCTCAGGGTGGC 0: 1
1: 0
2: 3
3: 18
4: 253
Right 1077135687 11:997133-997155 GAGAGACAGTGGCTTTATCTTGG 0: 1
1: 0
2: 0
3: 27
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077135681 Original CRISPR GCCACCCTGAGGCCCCTTCA CGG (reversed) Intronic
900138590 1:1129164-1129186 GTCACCCTGTGGCCCCCTCCAGG - Intergenic
900341930 1:2193711-2193733 TCCACCCTGGGGGCCCTGCAGGG + Exonic
900413317 1:2523626-2523648 CCCTCCCTGAGACCCCTGCACGG + Intronic
901026082 1:6279394-6279416 GCCACCCTCCTGCCCCATCAGGG - Intronic
901059336 1:6464946-6464968 TCCACCCTGATCCTCCTTCAGGG - Intronic
901325657 1:8363853-8363875 GCCACCCTGGGGCCCCTCGAAGG + Intronic
901816036 1:11794131-11794153 GGCACCCTGAGTCCCTCTCACGG + Intronic
902336866 1:15758974-15758996 CCCACCCGCAGGCCCCTCCAGGG - Intronic
902703646 1:18190030-18190052 GCCACCCTCAGCCCTCTTCCTGG + Intronic
903383813 1:22914091-22914113 GCCACCCTGAGAACCCCTCTGGG + Exonic
904355348 1:29935125-29935147 GCCCTCCTGAGTCTCCTTCATGG + Intergenic
904378443 1:30095944-30095966 GCCACCCTGAGTGCCCTGCAGGG + Intergenic
905870292 1:41399642-41399664 GCCAGCCTGAGGCCCAGGCAAGG + Intergenic
906532223 1:46530462-46530484 GCCTCCCAGAGGCCCTTTCAGGG + Intergenic
907858562 1:58327902-58327924 ACCACCCAGATCCCCCTTCAAGG + Intronic
910868896 1:91813732-91813754 GCCACCCAAAGGCCCCTCTATGG + Intronic
912517427 1:110225105-110225127 TGCACTCTGAGGCCCATTCAGGG + Intronic
915839248 1:159201908-159201930 GCCACCCTGTGCCCCCTTCCTGG + Exonic
916051087 1:161037731-161037753 GCCACCCCCTGGCCCCTTAATGG - Exonic
916349188 1:163829731-163829753 GCCACCTAGAGGCCATTTCATGG + Intergenic
916668889 1:166993724-166993746 GACCCCCTGAGGCCCATTCATGG + Intronic
919665812 1:200290519-200290541 GCCACCCAGAGGCCTTTTGATGG - Intergenic
919786582 1:201262087-201262109 GCCACTCTCAGGCCCCACCAGGG - Intergenic
920094728 1:203478854-203478876 GTGAGCCTGAGGCCCTTTCAAGG - Intronic
921117558 1:212108179-212108201 GCCACCTTGTATCCCCTTCATGG + Intergenic
922533358 1:226361644-226361666 GTCACTCTAAGGCCTCTTCATGG + Intronic
922698676 1:227745287-227745309 GCCCCACAGAGGCCCCTGCAGGG + Intronic
924946598 1:248850816-248850838 CCCACCCTGTGGCCCCTCCTTGG + Intronic
1062801516 10:384778-384800 CCCACCCTGAGGAGCCTCCAGGG - Intronic
1063004134 10:1952483-1952505 TCCACTCCGAGGCCTCTTCAGGG + Intergenic
1063174032 10:3535653-3535675 GCCACCCTGGGGCCTCTGCTCGG - Intergenic
1063686605 10:8242529-8242551 GACACCCTCAGGCCCCCTCCTGG - Intergenic
1065793472 10:29283118-29283140 TCCATCCTGAGGCAACTTCACGG + Intergenic
1066292850 10:34029698-34029720 GCCACCATGAGTCCCCTGCTGGG + Intergenic
1068911301 10:62381219-62381241 CCCTCCCTGCCGCCCCTTCAAGG - Intronic
1070305033 10:75234789-75234811 GCGGCCCTGAGGCCCCTCCCAGG + Intronic
1070479765 10:76870681-76870703 CCCACCCTGAGACCCCTCCCTGG + Intronic
1070987070 10:80698231-80698253 ACCTGCCTGAGGCCCCTGCAAGG - Intergenic
1074823190 10:117196892-117196914 CCCACCGTGAGGCCCCAGCAAGG + Intergenic
1075380210 10:122012767-122012789 GCCACCTGGAGCCCCCTCCATGG - Intronic
1075426820 10:122348420-122348442 GCCACCCAGAGACACCTTCTTGG + Intergenic
1076763269 10:132616200-132616222 GCCACCCTGTGGTTCTTTCAGGG - Intronic
1076763497 10:132617308-132617330 GCCACCCTGTGGCTCTCTCAGGG + Intronic
1077027247 11:446372-446394 CCCAGCCTGAAGCCCCTGCAGGG + Intergenic
1077135681 11:997087-997109 GCCACCCTGAGGCCCCTTCACGG - Intronic
1077329818 11:1979348-1979370 GCCCCACTGAAGCCCCTTCCGGG + Intronic
1078662094 11:13295904-13295926 GCCACCCCCAGTCCCCTTCCTGG + Intronic
1081131107 11:39381416-39381438 GCCACCTGGATGCCCCTCCAGGG - Intergenic
1083885216 11:65570193-65570215 GACCCCCTGAGGCCACTTCCAGG + Intergenic
1084089384 11:66870196-66870218 GGGACCCTGAGTCCCCTTCTGGG - Intronic
1084310167 11:68312387-68312409 GCCTCCCGGAGGCACCTCCAGGG + Intergenic
1084438169 11:69156057-69156079 GCCACCCTGGAGCCCCTGCCTGG - Intergenic
1085962557 11:81479958-81479980 GCATACCTGAGGCCACTTCAAGG - Intergenic
1086401142 11:86461730-86461752 GCCACCCAGATCCTCCTTCAAGG - Intronic
1089456964 11:118631347-118631369 TCCGCCCAGAGGCCCCTGCAAGG - Exonic
1090462790 11:126906847-126906869 GCCACTCTGACTTCCCTTCATGG - Intronic
1090511135 11:127376520-127376542 GCCACCCAGATTCCCCTTTAGGG - Intergenic
1202812796 11_KI270721v1_random:34527-34549 GCCCCACTGAAGCCCCTTCCGGG + Intergenic
1091389940 12:119920-119942 GCCACCCAGACCCTCCTTCAAGG - Intronic
1091596713 12:1883368-1883390 GCCACTCTTAGGTCTCTTCAGGG + Intronic
1091685346 12:2557547-2557569 TGCACACTGAGGCCCCTGCATGG + Intronic
1092002289 12:5043083-5043105 TCCACCCTCAGTCTCCTTCATGG + Intergenic
1093832708 12:23784133-23784155 CCCACCCTGAGGCCTGTGCATGG - Intronic
1093872264 12:24306626-24306648 GCAACGCTGAGGCCACTTCTGGG + Intergenic
1100861458 12:98811289-98811311 GTCCCCCTGGGTCCCCTTCAGGG - Intronic
1101489342 12:105197117-105197139 GGGACCCTGAAGCCCCTCCATGG + Intronic
1102392316 12:112559278-112559300 GCTCCCCTGATGCCCATTCAAGG + Intergenic
1103303015 12:119942556-119942578 GCCACCCACATGCCCCCTCAAGG + Intergenic
1104539057 12:129645361-129645383 ACCACCCTGAGGCCACAGCAAGG - Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1104858811 12:131914215-131914237 GCCACCCTGAGACCCATGCCAGG - Intronic
1106216528 13:27706853-27706875 ATCACCCTGAAGCCCATTCATGG - Intergenic
1107680350 13:42842035-42842057 TCCAAACTGTGGCCCCTTCATGG - Intergenic
1108521100 13:51247546-51247568 GCCACCAGGAAGTCCCTTCAAGG - Intronic
1110196621 13:72796299-72796321 GCCACTCTGAGATCCTTTCAGGG - Intronic
1112246240 13:97736623-97736645 GCCTCCTAGAGGCCCGTTCAAGG + Intergenic
1113495556 13:110725636-110725658 GGCACCCGGAGGCCTCCTCATGG + Intergenic
1113968998 13:114174200-114174222 GCGAACCTGAGGCCCGTGCAGGG - Intergenic
1115919661 14:38358484-38358506 GGCACCCTGTGGCCCAGTCAAGG + Intergenic
1119779089 14:77266327-77266349 GACACCCAGAAGCCCCTTCCTGG + Exonic
1122687453 14:103516497-103516519 GCCTCCCAGAGCACCCTTCAGGG - Intergenic
1122931615 14:104935464-104935486 GCCACAATGTGGCCCCTTCTGGG + Exonic
1123110943 14:105866602-105866624 AGCACCCTTCGGCCCCTTCAAGG - Intergenic
1124215511 15:27805042-27805064 GCCACCAAGAAGCCCCTGCAAGG + Intronic
1125677972 15:41512569-41512591 TCCACCTTGAGTGCCCTTCAAGG - Intronic
1129387367 15:75203181-75203203 GCCATCCCGAGGCCCCTAGAAGG + Intronic
1129738267 15:77977563-77977585 GCCACCTTGAGTCACTTTCAAGG + Intergenic
1130254098 15:82317885-82317907 GCCACCTTGAGTCACTTTCAAGG + Intergenic
1130486091 15:84399192-84399214 GCCCCCCTGAGGCCCCGCCCCGG + Intergenic
1130600873 15:85272086-85272108 GCCACCTTGAGTCACTTTCAAGG - Intergenic
1130985828 15:88843744-88843766 GGTACCCCGTGGCCCCTTCAAGG - Intronic
1131050343 15:89343462-89343484 GCCATCCACAGGCCTCTTCATGG - Intergenic
1132664084 16:1073692-1073714 GCCTGCCTGGGGCCCCCTCAAGG + Intergenic
1132848186 16:2010372-2010394 GCCTTCCAGAGGCCCCTTCTGGG - Intronic
1132899436 16:2245165-2245187 CCCACCCTGGGGACCCTGCATGG + Intronic
1132928954 16:2448824-2448846 TCCACCCTGAGACCCCTTCTCGG + Intronic
1133265318 16:4579939-4579961 CCCTCCCTCAGGCCCCTTCCCGG + Intronic
1133317295 16:4892643-4892665 CTCACTCTGAGGCCCCATCAGGG + Intronic
1135066457 16:19314322-19314344 GCCACCCAGATCCCCCTTCAAGG - Intronic
1135983468 16:27166790-27166812 GCCCCTATGAAGCCCCTTCAAGG + Intergenic
1136451341 16:30355808-30355830 GCCAGCCTGGGGCCCCTGGACGG + Intergenic
1138240588 16:55424324-55424346 CCCACCCTGAGGCCTGTGCAGGG + Intronic
1141011798 16:80407764-80407786 GCCACCCTGGTGAGCCTTCATGG + Intergenic
1141436339 16:84001881-84001903 GCCAGCCTGAGGCCCTCTCCAGG + Exonic
1141657496 16:85423887-85423909 GACCCCCTGAGGCCCCATCCAGG + Intergenic
1141870531 16:86782475-86782497 GAGACCCAGAGGCCCCTTCCAGG + Intergenic
1141950177 16:87334855-87334877 CCCACCCTCAGGCCACTCCAAGG + Intronic
1142468190 17:147725-147747 GCCACACTCTGGCCCCGTCAGGG + Intronic
1143918601 17:10313139-10313161 GCCACCCTGGAGCCCCTACTTGG + Exonic
1144092975 17:11874324-11874346 GCCTCTCTTAGGCCCCTTCAGGG - Intronic
1145374938 17:22338421-22338443 TCCCCCCTCAGGTCCCTTCAGGG - Intergenic
1146150624 17:30466665-30466687 GCCACTCTTAGGCCCCTTGTTGG - Exonic
1147925049 17:43941000-43941022 GCCAGCCTGAGGCCTCCTGAGGG - Intronic
1148086701 17:44997951-44997973 GCAGCCCAGAGGCCCCTGCAGGG + Intergenic
1148476404 17:47931595-47931617 CCAAACCTGAGGCCCCTTTAAGG + Intergenic
1148719239 17:49738995-49739017 ACCAGCCTGCAGCCCCTTCAAGG - Intronic
1148836798 17:50469724-50469746 GCCACCCTGAGACCCCTCAGGGG - Intronic
1151470438 17:74314475-74314497 GCCACCCTGAGCCCACCCCAAGG + Intronic
1151548582 17:74808215-74808237 TCCACTCTGTGGCCCCCTCAAGG - Intronic
1151704959 17:75762639-75762661 GCCACACTGAGGCGCCAGCAGGG + Intronic
1152378671 17:79931107-79931129 GCCACCCTGAGGCCACTGCACGG + Intergenic
1152797289 17:82314629-82314651 GCCATCCTGAGGCTCCTGAAGGG + Intergenic
1154218786 18:12434279-12434301 GCCACTCTGAGGGCCCCTCCAGG - Intergenic
1159755484 18:72358748-72358770 GCCACCCTGAGAAGGCTTCAGGG - Intergenic
1160439612 18:78879336-78879358 GCCAGCGTGACGCCCCTTCGAGG - Intergenic
1160439618 18:78879369-78879391 GCCAGCGTGATGCCCCTTCGGGG - Intergenic
1160439663 18:78879567-78879589 GCCAGCGTGACGCCCCTTCGAGG - Intergenic
1160439669 18:78879600-78879622 GCCAGCGTGACGCCCCTTCGAGG - Intergenic
1160439675 18:78879633-78879655 GCCAGCGTGACGCCCCTTCGAGG - Intergenic
1160439681 18:78879666-78879688 GCCAGCGTGACGCCCCTTCGAGG - Intergenic
1160439687 18:78879699-78879721 GCCAGCGTGACGCCCCTTCGAGG - Intergenic
1161767176 19:6214239-6214261 GCCACCCAGAGGCCCTTTGGGGG + Intronic
1162457661 19:10795787-10795809 GCCAGCATGAGTCCCCATCATGG + Intronic
1163659572 19:18568647-18568669 GCTGCCCTGAGACCCCCTCAAGG - Exonic
1164866306 19:31607117-31607139 AGCTCCCTGAGGCCCCTTGATGG + Intergenic
1165240061 19:34459251-34459273 GCCACAGTGAGGACCATTCAAGG - Intronic
1167044674 19:47042672-47042694 CCCACCCTGAGGCACTTACAAGG - Intronic
1167125236 19:47544745-47544767 GCCGCCCTGAGGCCGCTGCAGGG - Exonic
1167276545 19:48543556-48543578 GCCTCCCTGAAGCCACTGCAGGG + Intergenic
1167463459 19:49638333-49638355 CCCACCAAGAGACCCCTTCAAGG - Intronic
925146141 2:1584615-1584637 CCCACCCTGAGCCCCATGCAGGG + Intergenic
927489909 2:23514373-23514395 TGCACCCTGAGGCCACTTAAGGG - Intronic
929587415 2:43125300-43125322 GCCTCTCTGAGGGCTCTTCAGGG - Intergenic
934662207 2:96148985-96149007 GACACTCTGAGGCCTCCTCAGGG + Intergenic
936010570 2:108922666-108922688 GCCACCCTCTGGCTCCTTCAAGG - Intronic
937821813 2:126318831-126318853 GCCTCTCTGATTCCCCTTCAAGG + Intergenic
938971981 2:136441126-136441148 GCCCTACTGAGGCCCCTTAATGG + Intergenic
942775114 2:179572021-179572043 GCCACCCTGAGGCCACTCCCAGG - Intronic
943574090 2:189610418-189610440 GCTACTATCAGGCCCCTTCATGG - Intergenic
945580946 2:211593748-211593770 ACCACCCTGATACCCTTTCAAGG + Intronic
947107445 2:226682124-226682146 GTCACCCTGAGTTCTCTTCAGGG - Intergenic
948438444 2:237969367-237969389 GCTTCCCTGAGCCTCCTTCAGGG + Intronic
948523422 2:238556610-238556632 GCCACCCAGATGCCCCTTCCAGG + Intergenic
948560168 2:238847091-238847113 GCCACCCTGAGCCTCCTGCTCGG + Intergenic
948692554 2:239715774-239715796 GCCAACCTGAGGACCATTCTCGG - Intergenic
948861888 2:240756715-240756737 GCCATCCTGAGGCCACTTTTAGG - Intronic
948941888 2:241200910-241200932 GCCGCCCTGAAGCTCCGTCATGG - Intronic
1170402263 20:16000417-16000439 GCTACCTTGGGGCCCCTTTAAGG - Intronic
1171108626 20:22459842-22459864 GCCAGCCTTAGGCCACTTCTGGG + Intergenic
1171481966 20:25460989-25461011 CCCTCCCTGAGGCCCCTGCTCGG + Intronic
1171527858 20:25829990-25830012 TCCCCCCTCAGGTCCCTTCAGGG + Intronic
1171548968 20:26025890-26025912 TCCCCCCTCAGGTCCCTTCAGGG - Intergenic
1172965327 20:38830092-38830114 GCCACCCTGGGGCCCATGGAGGG + Intronic
1174133892 20:48365518-48365540 GCCCCCCAGAAGCCCCTTCCAGG + Intergenic
1174139213 20:48400925-48400947 GCATCCCTGAGGGCCCTTCCAGG + Intergenic
1175788013 20:61724042-61724064 TCCACCCTGTGCCCCCTGCATGG - Intronic
1176248276 20:64107749-64107771 CACACCCAGAGGCCCCTGCATGG - Intergenic
1176251947 20:64129316-64129338 GCCACCCTCAGGCTCCTGCCTGG + Intergenic
1176368078 21:6045610-6045632 GCCCCTCAGTGGCCCCTTCACGG + Intergenic
1176953366 21:15071682-15071704 GCCCCGATGAGGCCCCTTGAAGG + Intergenic
1178319983 21:31597849-31597871 GCCTGCGTGAGGCCCCTCCACGG - Intergenic
1178664390 21:34533926-34533948 GCCACCCTGAGCCTCCTTGCTGG - Intronic
1179755441 21:43492932-43492954 GCCCCTCAGTGGCCCCTTCACGG - Intergenic
1179888774 21:44325625-44325647 GCCACCCTGACTCCCCTCCCTGG - Intronic
1179922605 21:44515336-44515358 GCCCTCCTAAGGCACCTTCAGGG + Intronic
1180087431 21:45514265-45514287 GCCACCCTGGGGACCCTGCTTGG - Exonic
1181779832 22:25184671-25184693 GCCACCCTGAGAACTCTACATGG - Intronic
1181952134 22:26562125-26562147 GCCACCCTGTGGCCCCCGCCGGG - Intronic
1184058840 22:42069891-42069913 GCCTCTCTGAGGCCTCTTGAGGG - Intronic
1184114690 22:42415683-42415705 GCCTCCCAGAGGCCCCTTCAGGG + Intronic
949177060 3:1076872-1076894 GCCTCTCTGAGGCCACTCCATGG - Intergenic
953743851 3:45558105-45558127 GCCTCCCAGAGGCCTCTCCATGG - Intronic
954105235 3:48406217-48406239 GTCACTCTCAGGCCCCTCCATGG + Intronic
954680342 3:52342621-52342643 CCCACCCTCAGGCCCAGTCATGG + Intronic
954680594 3:52344002-52344024 CCCACCCTCAGGCCCAGTCATGG + Intronic
955904544 3:63793139-63793161 GCCACCCTTATTCTCCTTCAAGG + Intergenic
958883678 3:99701758-99701780 GCCTCACTGAGGCCTTTTCAGGG + Intronic
960684533 3:120283850-120283872 GCCAGCCTAATTCCCCTTCAGGG - Intronic
962372499 3:134832451-134832473 ACCACCCTGAGACCTGTTCATGG + Intronic
962840151 3:139225684-139225706 TCCACCCTGAGGCCCTCTCCAGG - Intronic
963416371 3:145000532-145000554 GCCACTCAGAGTCCCCTTCAGGG - Intergenic
968187629 3:196644020-196644042 GACACCCTGAGACCTCCTCATGG + Intronic
968760722 4:2441808-2441830 GCCACCTTGTGGCCTCTCCAGGG + Intronic
968917313 4:3502206-3502228 GCCACCCTAAGGGCCCGACACGG - Intergenic
969554921 4:7900894-7900916 GCTACCCTGAGACACCGTCAGGG + Intronic
969650642 4:8465842-8465864 GCCACACTGAGGCCTCCTCTGGG - Intronic
969712384 4:8851569-8851591 GACCCCCTGAGGCCCACTCACGG + Intronic
977681600 4:99804230-99804252 GCATTCCTGAGGCTCCTTCATGG - Intergenic
981573245 4:146175966-146175988 GCCACCCAGCGGTCCCTTCCCGG - Exonic
981746255 4:148055264-148055286 GCGATCCTGAGGCTCCTACATGG - Intronic
982236573 4:153256317-153256339 GCAGAGCTGAGGCCCCTTCAAGG + Intronic
983096471 4:163568256-163568278 GGGACCCTGAGACCCTTTCAAGG + Intronic
985760753 5:1747344-1747366 GCCACCCTGAGGCCCTGTCAGGG - Intergenic
986013900 5:3740799-3740821 GACACCCTGAGGCACCTGCAGGG - Intergenic
986669273 5:10128314-10128336 GCCACTCTGGAGCCCCTCCAGGG - Intergenic
986981881 5:13457528-13457550 GCCCCCCAGATTCCCCTTCAAGG + Intergenic
988495108 5:31738270-31738292 GCCACCCAGAAGCCCCTCCAAGG - Intronic
990734678 5:58846809-58846831 GCCAACCTGTGTCCTCTTCATGG - Intronic
993942738 5:94080502-94080524 ACCATCCAGATGCCCCTTCAAGG + Intronic
995858313 5:116616173-116616195 GCCATGCTGAGGCCCTGTCATGG - Intergenic
997122173 5:131186125-131186147 GAGACCCTGAGACCCTTTCAGGG - Intronic
997445829 5:133939473-133939495 GCTACTCTGTGGCCCATTCATGG + Intergenic
997589033 5:135061751-135061773 CCCACCCTGAGGGGCCTTCCTGG - Intronic
997664775 5:135621061-135621083 GCCATCTTGAAGCCCCTTCTAGG + Intergenic
997869799 5:137497716-137497738 GCCACCCAGGGTCCCTTTCAGGG + Intronic
1000023104 5:157336032-157336054 GCTTCCCTGAGGTCTCTTCATGG - Intronic
1001229048 5:169970084-169970106 ACTGCCCTGAGGCCCCTTAAAGG + Intronic
1001254226 5:170171402-170171424 GACATCCTGAGCCCCCTGCAAGG + Intergenic
1002344206 5:178536549-178536571 GTCACCCTCAGTCCCCTGCAAGG + Intronic
1004586310 6:17004604-17004626 GACACCCTGAGGCCAGCTCAAGG - Intergenic
1004721153 6:18268334-18268356 GTCACCCAGATGCCTCTTCAAGG - Intergenic
1006581224 6:35078958-35078980 TTCACCCAGAGCCCCCTTCATGG + Intronic
1006862620 6:37183124-37183146 GCCACCTCAAGGTCCCTTCAGGG + Intergenic
1007177686 6:39908036-39908058 CCCATGCTGAGGCACCTTCATGG - Intronic
1007792313 6:44317687-44317709 GCCACCCCAGGGCCCCTCCATGG + Intronic
1007816841 6:44530868-44530890 ACCACCCAGATCCCCCTTCAAGG - Intergenic
1010043582 6:71416203-71416225 GCCATCCTTAAGCCCCTGCAAGG + Intergenic
1010324065 6:74544762-74544784 CCCACACTGAGGCCCCTACTGGG - Intergenic
1014005225 6:116410252-116410274 CACTCCCTGAAGCCCCTTCATGG + Intronic
1018039215 6:159906937-159906959 TCCAACCTGAGGCCTCCTCATGG + Exonic
1023341605 7:39227485-39227507 GCAACTCCTAGGCCCCTTCATGG + Intronic
1028583721 7:92432822-92432844 GCCACCCTGAGGCCTTCTGAGGG - Intergenic
1032328744 7:130957321-130957343 GCCACCCTGAGCCCTCTTGCTGG - Intergenic
1032390506 7:131552565-131552587 GACACCCTGAGGACCCTCCTGGG + Intronic
1032732693 7:134659547-134659569 GCCACCCTGATGCCTCTTCTAGG + Intronic
1034131774 7:148725328-148725350 CACACCCAGATGCCCCTTCAAGG + Intronic
1034401674 7:150865721-150865743 CCCATCCTGGGGCCACTTCAAGG + Intergenic
1034717468 7:153256743-153256765 TCCTGCCAGAGGCCCCTTCAGGG - Intergenic
1034860749 7:154592688-154592710 TCCACCCTGAGACCCCTCCTCGG - Intronic
1035239851 7:157522357-157522379 GCCACGCTCAGCCCCCTCCATGG - Intergenic
1035310474 7:157964676-157964698 GCCAACCTGAGGCAGCATCATGG + Intronic
1035344752 7:158190759-158190781 GGCACCCCGTGGCCCCTGCATGG + Intronic
1035610238 8:957240-957262 GACAGCCAGAGGCCCCTCCAGGG + Intergenic
1035828763 8:2672527-2672549 GCACCCCTGGGGTCCCTTCACGG + Intergenic
1035870613 8:3133168-3133190 GCCGACCTGGGGCCCCTTCTTGG + Intronic
1035924365 8:3711332-3711354 GCCACCCAGATCCCCCTCCAAGG + Intronic
1037928668 8:22864940-22864962 ACCCCGATGAGGCCCCTTCACGG + Intronic
1038515425 8:28183758-28183780 GGCACCCTGAGGCCGCTGCATGG + Intronic
1039398615 8:37248247-37248269 AACACCCAGAGGTCCCTTCAGGG - Intergenic
1040530853 8:48265387-48265409 GCCTCCCTGTGGCCTCTCCAGGG - Intergenic
1041522697 8:58772722-58772744 GCCACCCTGTGGCCCCAGCTGGG - Intergenic
1041933242 8:63309747-63309769 AGCACCCTGAGTACCCTTCAGGG - Intergenic
1045499237 8:102732220-102732242 GCCACTCAGATCCCCCTTCAAGG - Intergenic
1047098208 8:121646820-121646842 GGGACCCTGAAGCCCTTTCAGGG - Intergenic
1048366911 8:133746142-133746164 GCCAGCTTCAGGCTCCTTCAGGG + Intergenic
1049196690 8:141319754-141319776 GACACCCTGAGTCCACTTTAGGG - Intergenic
1049269389 8:141686246-141686268 GAGATCCTGAGGCCCCTTCCCGG - Intergenic
1051444860 9:17129341-17129363 GCCACCCTGAGACTTCTTAAAGG - Intergenic
1053156620 9:35785328-35785350 GAACCCCTGAGGCACCTTCAGGG - Intergenic
1054149358 9:61588736-61588758 TCCCCCCTCAGGTCCCTTCAGGG - Intergenic
1054469118 9:65519847-65519869 TCCCCCCTCAGGTCCCTTCAGGG - Intergenic
1054805950 9:69395927-69395949 TCCTCCCTGAGGCCTCTGCAAGG + Intergenic
1054949624 9:70835468-70835490 GCCACCCTGAGTCCTCTGCTTGG + Intronic
1055511138 9:76996842-76996864 GTGTCCCAGAGGCCCCTTCAAGG + Intergenic
1056447304 9:86678293-86678315 GCCACCCTCTGACTCCTTCAAGG - Intergenic
1056741802 9:89262782-89262804 GCTATCCTGAAGCTCCTTCAAGG + Intergenic
1059234671 9:112751249-112751271 CCCACCCTGCCGCCCCTTCCCGG + Intronic
1059442188 9:114314648-114314670 GGCACCCTGTGGCCCAGTCAAGG + Intergenic
1060965743 9:127711545-127711567 GCCGCCCTGGGGGCCCTGCAGGG + Intronic
1061873135 9:133531242-133531264 GCAGCCCTGAGGCCCCTTCTGGG - Intergenic
1062275465 9:135728410-135728432 GCCACCCGCAGGCCCCTCCTTGG + Intronic
1062432546 9:136532512-136532534 TCCACCCTGGAGCCCCTTCCTGG - Intronic
1186949345 X:14605798-14605820 GTCACCCTGAAGCCCCAGCATGG - Intronic
1199551800 X:149069101-149069123 GCCACCAAGATTCCCCTTCAGGG + Intergenic
1200313032 X:155099304-155099326 TCCATCCTAAGGTCCCTTCATGG + Exonic