ID: 1077136227

View in Genome Browser
Species Human (GRCh38)
Location 11:1000495-1000517
Sequence CTGCCGCCGGAGGAGGGTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 359}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077136227_1077136238 9 Left 1077136227 11:1000495-1000517 CCCCCACCCTCCTCCGGCGGCAG 0: 1
1: 0
2: 0
3: 31
4: 359
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136227_1077136237 -9 Left 1077136227 11:1000495-1000517 CCCCCACCCTCCTCCGGCGGCAG 0: 1
1: 0
2: 0
3: 31
4: 359
Right 1077136237 11:1000509-1000531 CGGCGGCAGCGGGCTGCTCGTGG 0: 1
1: 0
2: 1
3: 24
4: 217
1077136227_1077136239 18 Left 1077136227 11:1000495-1000517 CCCCCACCCTCCTCCGGCGGCAG 0: 1
1: 0
2: 0
3: 31
4: 359
Right 1077136239 11:1000536-1000558 GTTCTCAGACTCGGCCTCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077136227 Original CRISPR CTGCCGCCGGAGGAGGGTGG GGG (reversed) Exonic