ID: 1077136229

View in Genome Browser
Species Human (GRCh38)
Location 11:1000497-1000519
Sequence CGCTGCCGCCGGAGGAGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077136229_1077136238 7 Left 1077136229 11:1000497-1000519 CCCACCCTCCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136229_1077136239 16 Left 1077136229 11:1000497-1000519 CCCACCCTCCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1077136239 11:1000536-1000558 GTTCTCAGACTCGGCCTCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077136229 Original CRISPR CGCTGCCGCCGGAGGAGGGT GGG (reversed) Exonic
900091919 1:924387-924409 TGCTGCCGCCGGCGGAGAGCGGG + Intergenic
900313850 1:2047646-2047668 TGATGCCGCCGGTGGAGGGGGGG - Intergenic
900369503 1:2325038-2325060 CACTGCCCGGGGAGGAGGGTGGG - Intronic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
901768484 1:11518652-11518674 GGCTGCCGAGGGAGGAGGCTGGG - Intronic
903455428 1:23483999-23484021 CGCTGGCGCGGGAGGAGGTGAGG - Exonic
903883802 1:26529880-26529902 CGGGGCCGCCGGAGGAGCGCGGG + Intronic
904236936 1:29122423-29122445 CGCTGCGGGCGGAGGAGGTCTGG - Exonic
904254999 1:29249257-29249279 AGCTGCCTCTGGAGGAGTGTGGG - Intronic
905726559 1:40257700-40257722 GGCTCCCGCCTGAGGAGGCTAGG - Intergenic
906124444 1:43418839-43418861 AGCAGCAGCAGGAGGAGGGTGGG + Intronic
906168956 1:43707760-43707782 CGCGGCCGGCGGGGGAGGGGCGG - Intronic
906345216 1:45010582-45010604 TGCTGCCGCTGGAGGTGGTTGGG + Exonic
906546448 1:46622647-46622669 GGCTCCCCCCTGAGGAGGGTTGG - Intergenic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
913449848 1:118985786-118985808 CGCTCCCGCGGGATGGGGGTGGG - Intronic
919705189 1:200669541-200669563 CGGTGCCGCCGGGCGTGGGTGGG - Intronic
922440670 1:225653103-225653125 TGCAGCCGCGGGAGGAGAGTCGG + Exonic
922739729 1:228008280-228008302 GGCTGCCGTCGGAGAAGGATGGG - Intronic
923191773 1:231626894-231626916 CGCCGCCGCCGGCGGCGGCTGGG - Exonic
924606878 1:245542672-245542694 CGCTGCCTTCTAAGGAGGGTGGG + Intronic
1063158728 10:3403522-3403544 CTCTGCCGCCTGAGGAGTGGGGG + Intergenic
1063664716 10:8054460-8054482 GGCGGCCGCCGGCGGAGGGGCGG - Intronic
1065140382 10:22714103-22714125 AGCTGCAGCCGGAGGAGGAGGGG + Intronic
1067806790 10:49398160-49398182 CGCAGCAGCCGGGGGTGGGTGGG - Intergenic
1069546738 10:69334524-69334546 CGCTGCCGGGGGAGAAGGGCTGG + Intronic
1070570794 10:77638200-77638222 CGCAGCCGGGGGAGGAGGGCTGG - Intronic
1075501701 10:122980601-122980623 GGCTGCAGCAGGAGCAGGGTTGG + Exonic
1077104757 11:837341-837363 AGCTGCAGCAGGAGGTGGGTGGG + Exonic
1077136229 11:1000497-1000519 CGCTGCCGCCGGAGGAGGGTGGG - Exonic
1077268784 11:1665567-1665589 CGTGGCTGCCGGAGGAGGGAGGG + Intergenic
1089398851 11:118152991-118153013 CGCTCCAGCCGCAGGAGGGGCGG + Intergenic
1091460804 12:642648-642670 CGCTGCCCACGGAGGGGGGCGGG + Intronic
1096077641 12:48815143-48815165 CGCAGCCGCCGCCGGAGGATGGG + Intronic
1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG + Intronic
1096157297 12:49347753-49347775 CGCTGCCGCCGATGGAAGGGGGG - Exonic
1100539931 12:95548486-95548508 GGCTGCCGCCGGGACAGGGTCGG + Intronic
1102381288 12:112468826-112468848 GGCTGAGGCCGGAGGAGGGCTGG + Intronic
1102548494 12:113674029-113674051 CACTGCCGCAGGTGGAGGGAGGG - Intergenic
1104775339 12:131387405-131387427 CGCTGCAGCCGGTGGGGTGTGGG - Intergenic
1104887093 12:132117160-132117182 CGCGCCCGCCTGAGGAGGGTTGG + Intronic
1105240916 13:18609305-18609327 CGCTGCGGCCGGAGGAGCTGGGG + Intergenic
1105472027 13:20703594-20703616 CGCTGGCGGCGGAGCAGGGATGG + Intronic
1110219583 13:73059219-73059241 GGCTGCCGGCGGAGGAGGGGAGG - Exonic
1114269016 14:21090377-21090399 CGCGGCGGGCGTAGGAGGGTGGG - Exonic
1119566897 14:75636476-75636498 CTCTGCGGCAGGAGGAGGGAGGG + Intronic
1125448465 15:39782953-39782975 CGCTGCCGACGGTGGGGGTTGGG + Intergenic
1126183644 15:45810256-45810278 CGCTGGAGGTGGAGGAGGGTTGG - Intergenic
1127997660 15:64163016-64163038 AGCTGAGGCCGGAAGAGGGTGGG + Exonic
1128144701 15:65326450-65326472 CGCTGCTGGCCGAGGAGGGGTGG + Intergenic
1128564997 15:68695267-68695289 GGGTGCTCCCGGAGGAGGGTGGG + Intronic
1129850419 15:78790646-78790668 TACTGCAGCCGCAGGAGGGTGGG - Intronic
1132342329 15:101086440-101086462 CGCAGGCGCCGGAGGAGGCCGGG - Intergenic
1132640842 16:977648-977670 GCCTGCCGCAGGAGGAGGGCCGG + Intronic
1132761623 16:1511229-1511251 TGCTGCCCCTGGAGGCGGGTGGG + Intronic
1132834559 16:1946310-1946332 AGCTGCCTCCAGAGGAGGCTCGG + Intronic
1134492204 16:14703597-14703619 CGCGGCGGCCGGAGCAGGGTGGG - Intergenic
1134497585 16:14742719-14742741 CGCGGCGGCCGGAGCAGGGTGGG - Intronic
1136153021 16:28364638-28364660 GGCGGCGGCCGGAGCAGGGTGGG + Intergenic
1136210062 16:28750635-28750657 GGCGGCGGCCGGAGCAGGGTGGG - Intergenic
1136421665 16:30138130-30138152 CGCTGCAGTGGCAGGAGGGTAGG + Intergenic
1142631716 17:1229850-1229872 CGGAGCCGCCGGGGGAGGGCGGG + Intergenic
1142764167 17:2056443-2056465 AGCGGCCGCCGGTGGAGGGGAGG - Intronic
1144952982 17:19004059-19004081 CACTGCTGCCGGGGGTGGGTGGG + Exonic
1146062016 17:29612647-29612669 CGCAGCCGCGGCAGGAGGCTGGG - Exonic
1146183037 17:30709330-30709352 CGCCGCCGTCGGAGGGGGCTGGG + Intergenic
1147317325 17:39627214-39627236 CGCGGGAGCGGGAGGAGGGTCGG - Exonic
1150416907 17:64995405-64995427 CGCAGCCTCCCGAGGAGGGGAGG + Intergenic
1151963408 17:77419230-77419252 CGCTGCCACAGCAGGAGGCTGGG - Intronic
1154027610 18:10723484-10723506 GGCTGTAGCTGGAGGAGGGTGGG + Intronic
1154448054 18:14450603-14450625 CGCTGCGGCCGGAGGAGCTGGGG - Intergenic
1156448568 18:37253990-37254012 CGCTGCCGGCGGGGAGGGGTCGG + Intronic
1158954067 18:62523298-62523320 CCATGCCGCCGGGGGAGGGCCGG - Exonic
1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG + Exonic
1160747807 19:720069-720091 CGCTGCGGCTGGGGGAGGGGAGG - Intronic
1160841840 19:1149855-1149877 CGCTGCCTGTGGTGGAGGGTGGG + Intronic
1161422309 19:4182584-4182606 CGCTTCCGCCGGAAGCGGGGCGG + Exonic
1161455368 19:4367161-4367183 CGCTGCCTGCAGAGCAGGGTGGG + Intronic
1162621730 19:11849060-11849082 CGCGGCCGCTGGATGTGGGTGGG + Intronic
1165311451 19:35031167-35031189 CACAGCCGCGGGAGGGGGGTGGG + Intronic
1165871406 19:38975795-38975817 CCCCGCAGCCGGAGGAGGGGCGG - Exonic
925928177 2:8685367-8685389 CGCTGGCGCTGGAGGAGGGCGGG + Intergenic
927141595 2:20134868-20134890 GACTGCCCCCTGAGGAGGGTGGG + Intergenic
927497221 2:23559104-23559126 GGCTGTAGCCGGGGGAGGGTCGG + Intronic
929962371 2:46506424-46506446 AGCTGCCTCCTGAGGATGGTAGG - Intronic
931253762 2:60553820-60553842 CGCGGCCCCCGGGGGAGGGGCGG + Intergenic
936012335 2:108932977-108932999 CGCTCCCGTAGGAAGAGGGTGGG + Intronic
936500488 2:113062432-113062454 GGCTGCCGGCAGAGGAGGGGAGG - Exonic
936528390 2:113258030-113258052 GGGTGGCGCCGGAGGTGGGTGGG - Intronic
937260122 2:120580083-120580105 CGCTGTCCCCAGAGGAAGGTGGG + Intergenic
938074128 2:128322863-128322885 CGCTGCCCGGGGAGGAGGGTGGG - Intergenic
938339806 2:130527833-130527855 CGCTCCCGCTGGAGGACGGAAGG - Exonic
938350030 2:130592917-130592939 CGCTCCCGCTGGAGGACGGAAGG + Exonic
948193596 2:236078809-236078831 CGCTGCAGGGGTAGGAGGGTGGG - Intronic
948608881 2:239154502-239154524 CGATGCCGAGGGTGGAGGGTGGG - Intronic
1168893125 20:1307176-1307198 CTCTGCCTCTGGAGGAGGGTGGG + Exonic
1169664522 20:8019500-8019522 CGCTGCCGCCGGAGCAGAGCCGG - Exonic
1171137426 20:22709027-22709049 GGCTGCCACTGGAAGAGGGTCGG + Intergenic
1171975978 20:31595092-31595114 CCCTGCCGATGGAGGGGGGTGGG - Intergenic
1172272745 20:33663716-33663738 CGCGGCGGCCGGAAGAGGGCGGG + Exonic
1175129183 20:56776438-56776460 CAGTGGCGCTGGAGGAGGGTGGG - Intergenic
1177905253 21:26966136-26966158 TGCCGCCGCCGGAGTAGAGTTGG + Exonic
1179659343 21:42864527-42864549 AGCTTCCTCCCGAGGAGGGTAGG - Intronic
1181162886 22:20968115-20968137 CGCTGCCGCCAGGAGGGGGTAGG + Intronic
1182435510 22:30327055-30327077 GGCGCCCGCCGGGGGAGGGTGGG - Intergenic
1183548503 22:38468023-38468045 GGCGGCCGCCGGCGCAGGGTGGG - Intergenic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
949970250 3:9397681-9397703 CGCCGCTGCCGGGGGAGGGGCGG + Intronic
951422969 3:22509813-22509835 TGCTGCAGGCGGATGAGGGTGGG - Intergenic
956080278 3:65549565-65549587 CGCTGCCGCCCGAGCGGGCTGGG - Intronic
963810233 3:149769299-149769321 AGCTGGGGCAGGAGGAGGGTTGG - Intronic
966362732 3:179148155-179148177 CTCTTCTGCCGGAGGAGGGGGGG + Intronic
967316280 3:188154311-188154333 CGCTCGCGCCGGGGGAGGGCTGG - Intronic
968225220 3:196968839-196968861 CGCCGCCGCCGGCGCAGGGCGGG + Intronic
968286125 3:197509967-197509989 AGCTGCCCCAGGAGGAGGGGGGG - Exonic
968456734 4:704196-704218 TGCTGCCCCCGGGGGAGGGGAGG - Intergenic
968653139 4:1767778-1767800 CGCTGCTGGCGGAGCGGGGTCGG - Intergenic
968756084 4:2417353-2417375 CGCTGCAGCCGGAGCAGGGCCGG - Intronic
972077287 4:35103887-35103909 TGCTGCCGGCTGAGGAGGGCTGG + Intergenic
975252584 4:72197439-72197461 CACTGCTGCCGGAGTAGGGAAGG - Intergenic
978361127 4:107931875-107931897 CTCCGCCGCCGGAGGAAGGGAGG - Exonic
981938223 4:150256183-150256205 CGGGGCAGCGGGAGGAGGGTGGG - Exonic
983398490 4:167233904-167233926 CGCGGCCGCCGGATGTGGGTGGG - Intronic
983904362 4:173168974-173168996 CGCTGCCGCCGGAGGGGGCCGGG - Intronic
984908088 4:184648844-184648866 CGCTACCGCCGGCGGAGGAGTGG - Intronic
985129699 4:186726903-186726925 CGCAGCCGAAGGAGGAGGGCGGG - Intergenic
985549203 5:524606-524628 CGCGGGCTCCGGGGGAGGGTGGG - Intergenic
985682016 5:1260721-1260743 CGCTGCAGCCCGAGGGGGCTGGG + Intronic
985892286 5:2724963-2724985 TGCTGCTGCCTGAGGAGGGGAGG + Intergenic
992550221 5:77852611-77852633 CGCTGCTCCAGGAGGGGGGTGGG + Intronic
996423765 5:123290788-123290810 GGCTGCCCCAGGAGGAGGGGTGG - Intergenic
998193027 5:140043016-140043038 CGCCGCCACTGGAGAAGGGTCGG - Exonic
1000305059 5:159987274-159987296 CGCCCCCGCCGCAGGAGGATCGG - Intergenic
1002160718 5:177312517-177312539 CGCAGGCGCCGGCGGAGGGGCGG + Intronic
1016461631 6:144285219-144285241 CGCTGGAGGCGGAGGAGGGAGGG - Intergenic
1016949454 6:149566265-149566287 CGCGGCCGCCCGGGGAGGGGAGG + Intergenic
1019143358 6:169962015-169962037 CGCAGCCCCAGGAGGAGGGACGG + Intergenic
1019989564 7:4682274-4682296 CGCCGCCGCCGGAGGCCGCTCGG + Intergenic
1022111620 7:27235773-27235795 TGTTGCAGCGGGAGGAGGGTAGG - Intergenic
1022351148 7:29566646-29566668 CGCTGCTCCCGGAGGCGGGCAGG + Exonic
1022704536 7:32790047-32790069 CACTGCATCCTGAGGAGGGTGGG - Intergenic
1025789921 7:64679948-64679970 CGCTGTCGCCAGAGGGTGGTAGG - Intronic
1026505684 7:70980628-70980650 TGCTGCAGCTGGAGGAAGGTAGG - Intergenic
1029302806 7:99598371-99598393 CGGTGCCGCAGGTGGAGGGAAGG + Intronic
1031604224 7:123749025-123749047 CGCCGCCGCTGCGGGAGGGTTGG - Exonic
1037759600 8:21733207-21733229 GGCTGCAGCCGGAGGAAGGTGGG - Intronic
1038828581 8:31033265-31033287 CGCAGCGGCCGCAGGAGGGGCGG - Exonic
1042020734 8:64369987-64370009 CGTGGAGGCCGGAGGAGGGTGGG + Intergenic
1043874002 8:85464347-85464369 CGCGTCCGCCGGAGGCGCGTAGG + Intronic
1044320072 8:90791690-90791712 CGCAGAGGCCGGAGGAGGGAGGG + Exonic
1045547275 8:103140539-103140561 CCCCGCAGCCGGAGGAGGGCTGG - Intronic
1047499234 8:125429653-125429675 GGCTGCAGCCGGAGGAAGGAGGG - Intergenic
1049220099 8:141425172-141425194 TGCTGCCACCGGGGGAGGGTGGG + Intronic
1049688915 8:143950293-143950315 CGCTGCCGACGGAGGAGCAGCGG - Exonic
1053350569 9:37411031-37411053 CGCTCCCTCTGGTGGAGGGTTGG + Intergenic
1054407725 9:64775084-64775106 CGCTGCGGCGGGGGGGGGGTGGG + Intergenic
1056763164 9:89428735-89428757 CCCTGCCCCTGGAGGTGGGTTGG - Intronic
1057533484 9:95875728-95875750 CGCCGCCGCCGGAGGAGGACAGG - Exonic
1059145686 9:111897142-111897164 CGCTCCCGCAGGAGGAGGACAGG - Exonic
1060508206 9:124214323-124214345 AGCTGGGGCAGGAGGAGGGTAGG - Intergenic
1061158895 9:128882176-128882198 CGCTGCGGCCGGCGGCGGGACGG + Intronic
1061999053 9:134206943-134206965 TGCTGCAGCCAGAGGAGGCTGGG - Intergenic
1062043302 9:134414009-134414031 CGCTGGCGCCGGAGGCCGGGCGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062289498 9:135788208-135788230 GGCTGCCGGCGGTGAAGGGTTGG - Intronic
1187172934 X:16869785-16869807 CGCAGCCGCTGGAGGAGGGAAGG + Exonic
1189002061 X:36957880-36957902 CGCTGCCGCCCGAGGACGCCAGG - Intergenic