ID: 1077136238

View in Genome Browser
Species Human (GRCh38)
Location 11:1000527-1000549
Sequence CGTGGACGTGTTCTCAGACT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077136221_1077136238 19 Left 1077136221 11:1000485-1000507 CCCCGCGGGCCCCCCACCCTCCT 0: 1
1: 0
2: 2
3: 46
4: 489
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136218_1077136238 25 Left 1077136218 11:1000479-1000501 CCCTGCCCCCGCGGGCCCCCCAC 0: 1
1: 0
2: 3
3: 44
4: 513
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136226_1077136238 10 Left 1077136226 11:1000494-1000516 CCCCCCACCCTCCTCCGGCGGCA 0: 1
1: 0
2: 0
3: 29
4: 321
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136215_1077136238 28 Left 1077136215 11:1000476-1000498 CCCCCCTGCCCCCGCGGGCCCCC 0: 1
1: 1
2: 16
3: 135
4: 1137
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136233_1077136238 3 Left 1077136233 11:1000501-1000523 CCCTCCTCCGGCGGCAGCGGGCT 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136235_1077136238 -1 Left 1077136235 11:1000505-1000527 CCTCCGGCGGCAGCGGGCTGCTC 0: 1
1: 0
2: 2
3: 16
4: 160
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136223_1077136238 17 Left 1077136223 11:1000487-1000509 CCGCGGGCCCCCCACCCTCCTCC 0: 1
1: 0
2: 7
3: 148
4: 1398
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136219_1077136238 24 Left 1077136219 11:1000480-1000502 CCTGCCCCCGCGGGCCCCCCACC 0: 1
1: 0
2: 8
3: 98
4: 1143
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136217_1077136238 26 Left 1077136217 11:1000478-1000500 CCCCTGCCCCCGCGGGCCCCCCA 0: 1
1: 0
2: 4
3: 63
4: 634
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136214_1077136238 29 Left 1077136214 11:1000475-1000497 CCCCCCCTGCCCCCGCGGGCCCC 0: 1
1: 1
2: 14
3: 186
4: 1579
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136222_1077136238 18 Left 1077136222 11:1000486-1000508 CCCGCGGGCCCCCCACCCTCCTC 0: 1
1: 0
2: 6
3: 61
4: 685
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136229_1077136238 7 Left 1077136229 11:1000497-1000519 CCCACCCTCCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136227_1077136238 9 Left 1077136227 11:1000495-1000517 CCCCCACCCTCCTCCGGCGGCAG 0: 1
1: 0
2: 0
3: 31
4: 359
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136216_1077136238 27 Left 1077136216 11:1000477-1000499 CCCCCTGCCCCCGCGGGCCCCCC 0: 1
1: 1
2: 4
3: 114
4: 1107
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136236_1077136238 -4 Left 1077136236 11:1000508-1000530 CCGGCGGCAGCGGGCTGCTCGTG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136234_1077136238 2 Left 1077136234 11:1000502-1000524 CCTCCTCCGGCGGCAGCGGGCTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136220_1077136238 20 Left 1077136220 11:1000484-1000506 CCCCCGCGGGCCCCCCACCCTCC 0: 1
1: 0
2: 7
3: 159
4: 1653
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136228_1077136238 8 Left 1077136228 11:1000496-1000518 CCCCACCCTCCTCCGGCGGCAGC 0: 1
1: 0
2: 3
3: 29
4: 363
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077136230_1077136238 6 Left 1077136230 11:1000498-1000520 CCACCCTCCTCCGGCGGCAGCGG 0: 1
1: 0
2: 0
3: 24
4: 259
Right 1077136238 11:1000527-1000549 CGTGGACGTGTTCTCAGACTCGG 0: 1
1: 0
2: 0
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077136238 Original CRISPR CGTGGACGTGTTCTCAGACT CGG Exonic