ID: 1077138561

View in Genome Browser
Species Human (GRCh38)
Location 11:1013500-1013522
Sequence GCGGCTCGTACTCACCCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077138561_1077138565 -6 Left 1077138561 11:1013500-1013522 CCTGCAGGGTGAGTACGAGCCGC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1077138565 11:1013517-1013539 AGCCGCCGGCCAGGCGTGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 100
1077138561_1077138573 6 Left 1077138561 11:1013500-1013522 CCTGCAGGGTGAGTACGAGCCGC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1077138573 11:1013529-1013551 GGCGTGCTGGGATCGGGGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 243
1077138561_1077138568 -1 Left 1077138561 11:1013500-1013522 CCTGCAGGGTGAGTACGAGCCGC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1077138568 11:1013522-1013544 CCGGCCAGGCGTGCTGGGATCGG 0: 1
1: 1
2: 1
3: 8
4: 136
1077138561_1077138564 -7 Left 1077138561 11:1013500-1013522 CCTGCAGGGTGAGTACGAGCCGC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1077138564 11:1013516-1013538 GAGCCGCCGGCCAGGCGTGCTGG 0: 1
1: 0
2: 4
3: 131
4: 615
1077138561_1077138569 0 Left 1077138561 11:1013500-1013522 CCTGCAGGGTGAGTACGAGCCGC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1077138569 11:1013523-1013545 CGGCCAGGCGTGCTGGGATCGGG 0: 1
1: 0
2: 2
3: 12
4: 121
1077138561_1077138574 29 Left 1077138561 11:1013500-1013522 CCTGCAGGGTGAGTACGAGCCGC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1077138574 11:1013552-1013574 CAGCTCCAGCTGCTGCTCATAGG 0: 1
1: 0
2: 13
3: 103
4: 676
1077138561_1077138570 1 Left 1077138561 11:1013500-1013522 CCTGCAGGGTGAGTACGAGCCGC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1077138570 11:1013524-1013546 GGCCAGGCGTGCTGGGATCGGGG 0: 1
1: 0
2: 0
3: 14
4: 188
1077138561_1077138572 5 Left 1077138561 11:1013500-1013522 CCTGCAGGGTGAGTACGAGCCGC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1077138572 11:1013528-1013550 AGGCGTGCTGGGATCGGGGCAGG 0: 1
1: 0
2: 1
3: 23
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077138561 Original CRISPR GCGGCTCGTACTCACCCTGC AGG (reversed) Exonic
900340327 1:2185578-2185600 GCGGCTGGGACACACTCTGCAGG - Intronic
902037424 1:13467845-13467867 TTGGCTCGTACTCACCCCACAGG - Intergenic
902470006 1:16642730-16642752 GCGGCCCCTCCTCACTCTGCTGG - Intergenic
1066013693 10:31217255-31217277 GCGGCCCGTGAGCACCCTGCAGG - Intergenic
1067338094 10:45380201-45380223 GAGGCTGATACTCTCCCTGCAGG + Intronic
1072617998 10:97062577-97062599 CCGACTCCTCCTCACCCTGCAGG - Intronic
1076669994 10:132115203-132115225 GCGGCTAGGGGTCACCCTGCCGG + Intronic
1077138561 11:1013500-1013522 GCGGCTCGTACTCACCCTGCAGG - Exonic
1082790036 11:57340814-57340836 GCTGCTCTTACTCATCCTTCGGG - Intronic
1083654120 11:64220802-64220824 GCGGCTGGTACCCACCCTTTGGG + Intronic
1086553760 11:88085197-88085219 GAGGTTGGTTCTCACCCTGCAGG - Intergenic
1096672989 12:53211193-53211215 GAGGCTAGCACACACCCTGCAGG + Exonic
1102547459 12:113667028-113667050 CCAGCTCCTACTCACCCTCCAGG - Intergenic
1103992356 12:124807750-124807772 ACGGCACGTACTGAACCTGCAGG + Exonic
1104531115 12:129572033-129572055 TCCGCAGGTACTCACCCTGCAGG + Intronic
1118262506 14:64260581-64260603 GCAGCTAGTGCTCACCCTCCTGG - Exonic
1132463081 16:64983-65005 GCTGCTCGTGCTGTCCCTGCGGG + Exonic
1132549752 16:549481-549503 GCCGCCCGTGCCCACCCTGCAGG - Intronic
1142404945 16:89883229-89883251 GCGTCTCGCACTGACCCTGGGGG + Intronic
1142685669 17:1575732-1575754 GCTGCTCCTTCTCAGCCTGCTGG - Exonic
1147182250 17:38693732-38693754 GTGGTTCCTCCTCACCCTGCTGG - Intergenic
1147996696 17:44363582-44363604 CCGGCTGAGACTCACCCTGCGGG + Exonic
1154078204 18:11225856-11225878 GCGGCTCCTACTCCAGCTGCTGG + Intergenic
1160893090 19:1389695-1389717 GCTGCACGTGCTCACGCTGCAGG - Intronic
1161348576 19:3779771-3779793 GCCCCAGGTACTCACCCTGCAGG + Exonic
1162951307 19:14073426-14073448 GCGGCCGGTGCTCAACCTGCCGG + Exonic
1165831232 19:38731349-38731371 TCAGCCTGTACTCACCCTGCCGG - Exonic
1167560739 19:50225578-50225600 GCCGCTCCAGCTCACCCTGCCGG - Exonic
934519922 2:95013648-95013670 TCGACTCCCACTCACCCTGCTGG - Intergenic
935371800 2:102355717-102355739 GCCGCTCGCAAGCACCCTGCAGG - Intronic
936608065 2:113977195-113977217 TGGGCTGGTACTCACTCTGCAGG + Intergenic
1169131124 20:3166909-3166931 GCGGCCCGGCCTCTCCCTGCTGG + Exonic
1171386340 20:24771722-24771744 GTTGCTCCTGCTCACCCTGCCGG - Intergenic
1172838375 20:37887354-37887376 GAGGCTCCTCCTCACCCTGGAGG - Intergenic
1174157790 20:48528044-48528066 GCGGCTCCTCCTCAGGCTGCAGG + Intergenic
1175036251 20:56004108-56004130 GCTGCTGGTCCTCACGCTGCCGG - Exonic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
966855325 3:184189709-184189731 GCGCCTCATATTCACGCTGCTGG - Exonic
969675374 4:8611508-8611530 GAGGCTGGGACTCAGCCTGCAGG - Intronic
978852896 4:113358973-113358995 GGGGCTCGTGCCCCCCCTGCAGG - Exonic
998040298 5:138947209-138947231 GCACCTGGTACTCAGCCTGCAGG + Exonic
999262240 5:150245253-150245275 GCTGCTCGTCCTCGCCCTGTGGG - Intronic
1003367162 6:5485772-5485794 GCGGCTCATGGCCACCCTGCAGG - Intronic
1003765330 6:9229982-9230004 GCTGCTCGGACTCTCACTGCAGG - Intergenic
1008525692 6:52404651-52404673 GTGGCTGGTCCTCACCCTGTTGG + Exonic
1023801512 7:43839017-43839039 GCGGCTCGCACGCCCCCTGCTGG + Intergenic
1024093406 7:45966004-45966026 GCGGTTCGAACCCACCATGCAGG + Intergenic
1036195406 8:6708996-6709018 GCGGCACGTGCTCTCCGTGCTGG - Intronic
1036709138 8:11067204-11067226 GCGGCTCTGACTCTCCCAGCAGG + Intronic
1037879463 8:22565865-22565887 GCGTCTCCCACTCACCCGGCCGG - Exonic
1044474523 8:92610645-92610667 GCAACTTGGACTCACCCTGCCGG - Intergenic
1045055468 8:98364456-98364478 GGGGCTCTTACTCAGCCTCCGGG - Intergenic
1048793743 8:138129302-138129324 CCGGCTCCTACTCAGCCTTCGGG + Intergenic
1061706734 9:132458644-132458666 GCGGCTTGTAGTGACCCTACTGG - Intronic
1061936510 9:133860660-133860682 GCCTCTCCTTCTCACCCTGCTGG + Intronic
1062151583 9:135022054-135022076 GCGGATCGGACTCTCCCAGCAGG + Intergenic