ID: 1077139662

View in Genome Browser
Species Human (GRCh38)
Location 11:1018563-1018585
Sequence ACACACTCCCCGCCTACGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077139662_1077139672 30 Left 1077139662 11:1018563-1018585 CCCGCCGTAGGCGGGGAGTGTGT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1077139672 11:1018616-1018638 AGTAGTCGTTCTTGTTTGAGTGG 0: 1
1: 0
2: 0
3: 5
4: 73
1077139662_1077139670 -6 Left 1077139662 11:1018563-1018585 CCCGCCGTAGGCGGGGAGTGTGT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1077139670 11:1018580-1018602 GTGTGTGGTGTGTGGGGTTTGGG 0: 1
1: 2
2: 23
3: 222
4: 1093
1077139662_1077139669 -7 Left 1077139662 11:1018563-1018585 CCCGCCGTAGGCGGGGAGTGTGT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1077139669 11:1018579-1018601 AGTGTGTGGTGTGTGGGGTTTGG 0: 1
1: 0
2: 14
3: 175
4: 1034
1077139662_1077139671 -5 Left 1077139662 11:1018563-1018585 CCCGCCGTAGGCGGGGAGTGTGT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1077139671 11:1018581-1018603 TGTGTGGTGTGTGGGGTTTGGGG 0: 1
1: 13
2: 167
3: 627
4: 1992

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077139662 Original CRISPR ACACACTCCCCGCCTACGGC GGG (reversed) Exonic
920749562 1:208660821-208660843 TCTCATTCCCCGCCTACTGCTGG - Intergenic
1073449761 10:103602467-103602489 ACACAGTGCCCGCCAAGGGCAGG - Exonic
1074618475 10:115093460-115093482 TCCCGCTCCCCGCCTCCGGCCGG + Intronic
1077139662 11:1018563-1018585 ACACACTCCCCGCCTACGGCGGG - Exonic
1080750086 11:35143017-35143039 ACACCCTCCCCACCCACTGCAGG - Intronic
1088711347 11:112511681-112511703 ACACACTCCCCATCTACCACAGG + Intergenic
1090413293 11:126523603-126523625 CCACACTTCCCGCCTTCTGCTGG + Intronic
1096747326 12:53737580-53737602 ACACACACCCTGTCTTCGGCCGG - Intergenic
1098961884 12:76747326-76747348 ACACACTCACTGCTTACTGCAGG + Intergenic
1103172147 12:118830519-118830541 ACACACTCCCCACCCATGGGAGG - Intergenic
1118973994 14:70661835-70661857 ACACCCTAACCGCCTAAGGCTGG + Intronic
1122953487 14:105059122-105059144 GCACACTCCCCTCCCAGGGCAGG + Intronic
1134773416 16:16830803-16830825 ACTCCCTCCCCACCTACAGCTGG + Intergenic
1139060525 16:63245244-63245266 ACACCCTCACCACCTATGGCTGG - Intergenic
1142034203 16:87853765-87853787 ACCCACTCCCCGCCTCCCTCCGG - Intronic
1142122422 16:88393481-88393503 AGGCACCTCCCGCCTACGGCAGG - Intergenic
1142270763 16:89088255-89088277 ACACACTGCCCTCCCACTGCAGG - Intergenic
1149988546 17:61367056-61367078 ACACACTCCCTGCCAATGACAGG - Intronic
1151532065 17:74712924-74712946 ACAGACTCCCAGCCTTCTGCTGG + Exonic
1160053725 18:75460293-75460315 AAACACACCCTGCCTACAGCTGG + Intergenic
1160232314 18:77057805-77057827 AAACACTCCCCGCCTTCCTCAGG - Intronic
1160382545 18:78471684-78471706 ACACCCTCCCCGTCTGCTGCTGG + Intergenic
1161956909 19:7501202-7501224 ACGCGCACGCCGCCTACGGCTGG + Exonic
1163692955 19:18746979-18747001 ACACACTCTCAGCCCAGGGCAGG - Intronic
1164302175 19:23972189-23972211 ACACACGCCCCGCCATCGGAAGG + Intergenic
1164371845 19:27650254-27650276 AAACACTCCCGGCCAACCGCAGG - Intergenic
925189430 2:1870963-1870985 ACACAGCCCCAGCCTAGGGCAGG - Intronic
926135077 2:10330791-10330813 ACTCACTTCCTGCCCACGGCAGG + Intronic
935335547 2:102012464-102012486 ACACACACCCAGCCTAGGACTGG - Intronic
937986875 2:127641946-127641968 CCACACTCCCAGCCCAGGGCGGG - Intronic
943033747 2:182716010-182716032 CCACCCTCCCCGCCCGCGGCAGG + Intergenic
1183750770 22:39719185-39719207 TCACACTCCCTGCCCAGGGCGGG + Intergenic
950570969 3:13799706-13799728 ACACAGTCCCTGCCTCCGGCTGG + Intergenic
961663743 3:128483990-128484012 ACACACTCCCGGCCTTCTGCAGG + Exonic
968830660 4:2931653-2931675 ACCCGCTCCCAGCCTACAGCAGG - Exonic
980672179 4:136024501-136024523 ACACATTCCAAGCCTACGGAGGG + Intergenic
983865334 4:172759570-172759592 ACACACCCCCTGCCTATGGGAGG - Intronic
999242367 5:150135400-150135422 ACACACTCCCCGACTGAGCCAGG + Intronic
999265317 5:150263677-150263699 ACACACTCCCCTCCTTCCACTGG + Intronic
1003552170 6:7108959-7108981 ACACTCACCCCGCCAACGGAAGG - Intronic
1007178941 6:39914784-39914806 AAACACTCCCCTCCAAAGGCAGG + Intronic
1007264818 6:40588065-40588087 CCCCACTCCCAGCCTAGGGCCGG - Intergenic
1009734743 6:67662556-67662578 ACACACTCCCTGGCTATGGCAGG + Intergenic
1013447525 6:110245821-110245843 ACACACTCCCTGCCTCAAGCAGG + Intronic
1019343695 7:519851-519873 ACCCTCTCCCCGCCGCCGGCCGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019998954 7:4743820-4743842 ACCCACTCCCAGGCTAAGGCGGG - Intronic
1023733021 7:43210103-43210125 ACTCACACCCCACATACGGCTGG - Intronic
1024521109 7:50304603-50304625 CCACACTCCCCGCCCCCAGCCGG - Intronic
1037809683 8:22080207-22080229 CCTCTCTCCCCGCCTATGGCAGG + Exonic
1040015138 8:42693406-42693428 ACACACTCCCTGCCTTCTGGAGG - Intergenic
1055404922 9:75964560-75964582 ACAGACTCTCCGCTTACGGAAGG - Intronic
1058135807 9:101306319-101306341 ACAGGCTCCCCGCCTCAGGCTGG - Intronic
1061712747 9:132499039-132499061 ACACAGTCCCTGCCGGCGGCGGG - Intronic
1201571926 Y:15424012-15424034 ACACACACCACTCCTACCGCAGG - Intergenic