ID: 1077140873

View in Genome Browser
Species Human (GRCh38)
Location 11:1024334-1024356
Sequence GGTTAGCGGCAGCGGCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077140873_1077140878 1 Left 1077140873 11:1024334-1024356 CCAAGATGCCGCTGCCGCTAACC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1077140878 11:1024358-1024380 CGGCCACTGCAGTCCCACCCAGG 0: 1
1: 0
2: 6
3: 80
4: 1784
1077140873_1077140879 2 Left 1077140873 11:1024334-1024356 CCAAGATGCCGCTGCCGCTAACC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1077140879 11:1024359-1024381 GGCCACTGCAGTCCCACCCAGGG 0: 1
1: 0
2: 4
3: 45
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077140873 Original CRISPR GGTTAGCGGCAGCGGCATCT TGG (reversed) Intronic
906538863 1:46569515-46569537 GGAAAGCGGCAGCGGATTCTCGG + Intronic
913671308 1:121098771-121098793 GGTGAGAGGCAGCGGCAGCCTGG + Intergenic
914023076 1:143886192-143886214 GGTGAGAGGCAGCGGCAGCCTGG + Intergenic
914661562 1:149794134-149794156 GGTGAGAGGCAGCGGCAGCCTGG + Intronic
919768215 1:201140851-201140873 GCTGAGCGGCAGCAGCACCTAGG - Intronic
921010291 1:211134164-211134186 GGCTAGCGGCAGCCGCCTCCGGG + Intergenic
1063437389 10:6045401-6045423 GTTTAGCGGCAGCTGCTTGTAGG - Intronic
1064708115 10:18093985-18094007 GGAGTGCGGCAGCGCCATCTCGG + Intergenic
1065110604 10:22436772-22436794 GGGTAGCGGCCCCGGCCTCTTGG - Intronic
1074979248 10:118606439-118606461 GGGCAGCAGCAGCAGCATCTGGG + Intergenic
1077140873 11:1024334-1024356 GGTTAGCGGCAGCGGCATCTTGG - Intronic
1080158699 11:29144861-29144883 GGTTAGCGGATGCTGCCTCTTGG + Intergenic
1080458339 11:32434550-32434572 GGATAGCGGAAGCGGCGGCTGGG - Intronic
1082979060 11:59103461-59103483 GGTTAGCTGCTGGGGCATCAAGG + Intergenic
1083782913 11:64927182-64927204 GGTTATTGACAGCGGCTTCTTGG - Intronic
1088356711 11:108951710-108951732 GGTTAGCAGCATCTGCTTCTGGG - Intergenic
1097078255 12:56410783-56410805 GGGTAGCTGCAGCGGCACCCGGG + Intergenic
1109145795 13:58777805-58777827 GGTTTGCGGCAGGAGAATCTAGG - Intergenic
1109180773 13:59211943-59211965 TTTTACTGGCAGCGGCATCTGGG - Intergenic
1124002121 15:25768244-25768266 GGTGAGCGGCAGGGGCTCCTGGG + Intronic
1134933098 16:18223834-18223856 GGTTAACAGCAGCTGCCTCTGGG + Intergenic
1137387572 16:48055632-48055654 GGCTAGTGGCAGCTGCTTCTGGG - Intergenic
1139390109 16:66601925-66601947 GGGTAGCTGCAGCTGCACCTGGG + Intergenic
1141956566 16:87375894-87375916 GGGTGGCGGCAGGGGCAGCTTGG - Intronic
1142408277 16:89903202-89903224 GGTAAGTGGCAGCGGCTTCTTGG - Intronic
1144695368 17:17300855-17300877 GGGCAACTGCAGCGGCATCTGGG - Intergenic
1146064329 17:29622881-29622903 GGTTGATGGCAGCGGCAGCTGGG - Exonic
1147584932 17:41648561-41648583 GAGGAGCGGCAGCGGCTTCTGGG + Intergenic
1153723875 18:7936262-7936284 GGGTAGCTGCAGCTGCACCTGGG - Intronic
1154298687 18:13173887-13173909 GGTGAGTTGCAGAGGCATCTTGG + Intergenic
1156457071 18:37300830-37300852 GGTGAGCAGCAGTGGCATCTGGG + Intronic
1160489538 18:79325662-79325684 GGTCAGTGGCAGTGGCACCTGGG + Intronic
1165792864 19:38502523-38502545 GTTCAGCGCCAGCGCCATCTCGG - Exonic
929668457 2:43851773-43851795 GGTTCTGGGCAGCCGCATCTGGG - Exonic
930611900 2:53553778-53553800 GGTTGGCTGCAGCTGCACCTAGG - Intronic
930747896 2:54903647-54903669 TGTTAGCAGCAGCTGCCTCTGGG - Intronic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1183528079 22:38336103-38336125 GGTGAGCGCCAGCAGCAGCTGGG - Intronic
957678590 3:83403680-83403702 GGATGGCTGCAGAGGCATCTAGG - Intergenic
959111968 3:102133208-102133230 GGGTAGTGACAGAGGCATCTGGG + Intronic
961536266 3:127572881-127572903 GGGCAGGGGCAGCGGCAGCTGGG + Intergenic
971669907 4:29543074-29543096 GGGCAGCTGCAGCTGCATCTAGG + Intergenic
975023481 4:69520439-69520461 GGGCAGCTGCAGCAGCATCTGGG - Intronic
978964683 4:114726013-114726035 GGGTGGCAGCAGCGGCATCCAGG + Intergenic
979448311 4:120840090-120840112 GGGTAGCTGAAGCCGCATCTGGG + Intronic
985697424 5:1348613-1348635 GGTCAGGGGCAGGGACATCTAGG + Intergenic
995206112 5:109483189-109483211 GGTTGGAGGCAGAGGCAACTGGG + Intergenic
1002326782 5:178415000-178415022 GGTCAGCAGCAGCTGCATTTTGG - Intronic
1006394382 6:33777585-33777607 CATTATCGGCAGCAGCATCTCGG - Intronic
1010883927 6:81214780-81214802 GGTTGGCTGCAGCTGCACCTGGG - Intergenic
1018845321 6:167551743-167551765 GGTGAGAGGCAGAGGCCTCTGGG + Intergenic
1028599701 7:92588902-92588924 GCTTAGCGGCATCTGCTTCTGGG - Intronic
1029414919 7:100436472-100436494 GGTTTCCGGTAGCGGCGTCTAGG - Exonic
1038646318 8:29365344-29365366 CCTGAGGGGCAGCGGCATCTGGG + Intergenic
1057468395 9:95337105-95337127 GGGTAGCTGCAGGGGCACCTGGG - Intergenic
1058091754 9:100813754-100813776 GGTTAGCTGCAGTGGTACCTGGG + Intergenic
1058947091 9:109867652-109867674 GGTTGGCGGCAGCGCCTTCACGG - Intronic
1061496391 9:130977215-130977237 GGTCAGGGGCTGCAGCATCTGGG + Intergenic
1188207672 X:27380419-27380441 GGGTGGCTGCAGCTGCATCTGGG - Intergenic
1197730815 X:129807766-129807788 GGAGTGCGGCAGCGCCATCTTGG - Intronic
1200155376 X:153972168-153972190 AGATGGCGGCGGCGGCATCTCGG + Intergenic
1200178699 X:154137035-154137057 GGTGAGCGGCGGCGGCGGCTCGG - Intergenic