ID: 1077141284

View in Genome Browser
Species Human (GRCh38)
Location 11:1026025-1026047
Sequence GGCCAGCGCTTCGTATTCGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077141284_1077141290 18 Left 1077141284 11:1026025-1026047 CCGTCGAATACGAAGCGCTGGCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1077141290 11:1026066-1026088 GCCCTCCCCGTAGAGGGTGCAGG 0: 1
1: 0
2: 0
3: 12
4: 127
1077141284_1077141289 12 Left 1077141284 11:1026025-1026047 CCGTCGAATACGAAGCGCTGGCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1077141289 11:1026060-1026082 GACGTGGCCCTCCCCGTAGAGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1077141284_1077141298 26 Left 1077141284 11:1026025-1026047 CCGTCGAATACGAAGCGCTGGCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1077141298 11:1026074-1026096 CGTAGAGGGTGCAGGTGGATGGG 0: 1
1: 0
2: 0
3: 17
4: 130
1077141284_1077141297 25 Left 1077141284 11:1026025-1026047 CCGTCGAATACGAAGCGCTGGCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1077141297 11:1026073-1026095 CCGTAGAGGGTGCAGGTGGATGG 0: 1
1: 0
2: 0
3: 18
4: 178
1077141284_1077141288 11 Left 1077141284 11:1026025-1026047 CCGTCGAATACGAAGCGCTGGCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1077141288 11:1026059-1026081 TGACGTGGCCCTCCCCGTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1077141284_1077141286 -4 Left 1077141284 11:1026025-1026047 CCGTCGAATACGAAGCGCTGGCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1077141286 11:1026044-1026066 GGCCGTCGAAGGTGATGACGTGG 0: 1
1: 0
2: 0
3: 6
4: 42
1077141284_1077141293 21 Left 1077141284 11:1026025-1026047 CCGTCGAATACGAAGCGCTGGCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1077141293 11:1026069-1026091 CTCCCCGTAGAGGGTGCAGGTGG 0: 1
1: 0
2: 1
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077141284 Original CRISPR GGCCAGCGCTTCGTATTCGA CGG (reversed) Exonic
902968568 1:20030143-20030165 GACCAGCGCTTAGCATACGAAGG + Intronic
905441206 1:37997448-37997470 GGCCAGGGCTTCGTACCGGATGG - Exonic
922024533 1:221738379-221738401 GGGCAGAGCTTCTTATTCTAAGG - Intronic
1064029034 10:11871224-11871246 TGCCAGCGCTTCCTATTCTTGGG + Exonic
1077141284 11:1026025-1026047 GGCCAGCGCTTCGTATTCGACGG - Exonic
1112362698 13:98731307-98731329 GACCAGCCCTTCCTATTCGCCGG - Intronic
1112776093 13:102845803-102845825 GCCCTGCGCGTCGTATTAGACGG + Exonic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1125717252 15:41826318-41826340 GGCCAGCGCCCCGTAAACGAGGG - Exonic
1127433476 15:58934145-58934167 GGCCAGCCCTTCCTATTCTTTGG - Intronic
1142804850 17:2366040-2366062 GCCCAGCGCTTCTTTTTGGATGG + Intronic
1181351480 22:22261595-22261617 GGCCAGGGCTTCCAATTGGATGG + Intergenic
1183481516 22:38068071-38068093 GGCCAGCGCCTCGGCTTCCATGG + Intronic
949614109 3:5735393-5735415 GGCCAGTGCTTCTTAGTCTATGG - Intergenic
962493914 3:135920642-135920664 GGCCAGGGCTTCCTATTCCCAGG + Intergenic
998130163 5:139647877-139647899 GGCCAGAGATTCCTAGTCGAGGG - Intronic
1003156023 6:3595298-3595320 GGACAGGGCTTCATGTTCGACGG - Intergenic
1018936622 6:168277846-168277868 CTCCAGCGCTTCGTATTCCAAGG + Intergenic
1048529014 8:135230536-135230558 GGCCAGAGCTTCTTTTTCAAAGG - Intergenic
1189292370 X:39895410-39895432 GGCCAGCGCTTCCTGCTGGACGG + Intergenic
1199595810 X:149505048-149505070 GGCCTGCGTTTCGGATCCGAGGG + Intronic