ID: 1077142142

View in Genome Browser
Species Human (GRCh38)
Location 11:1029383-1029405
Sequence GGGTAGCGGCATGGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 296}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077142135_1077142142 -3 Left 1077142135 11:1029363-1029385 CCGGCTGTGGGTGGGCGTGGGGG 0: 1
1: 0
2: 12
3: 92
4: 724
Right 1077142142 11:1029383-1029405 GGGTAGCGGCATGGTGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 296
1077142123_1077142142 16 Left 1077142123 11:1029344-1029366 CCCAGCGGCCCAGGGTGCACCGG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1077142142 11:1029383-1029405 GGGTAGCGGCATGGTGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 296
1077142125_1077142142 15 Left 1077142125 11:1029345-1029367 CCAGCGGCCCAGGGTGCACCGGC 0: 1
1: 0
2: 0
3: 23
4: 160
Right 1077142142 11:1029383-1029405 GGGTAGCGGCATGGTGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 296
1077142129_1077142142 7 Left 1077142129 11:1029353-1029375 CCAGGGTGCACCGGCTGTGGGTG 0: 1
1: 0
2: 0
3: 22
4: 173
Right 1077142142 11:1029383-1029405 GGGTAGCGGCATGGTGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 296
1077142120_1077142142 25 Left 1077142120 11:1029335-1029357 CCGTGCACACCCAGCGGCCCAGG 0: 1
1: 0
2: 5
3: 36
4: 329
Right 1077142142 11:1029383-1029405 GGGTAGCGGCATGGTGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 296
1077142119_1077142142 30 Left 1077142119 11:1029330-1029352 CCGCTCCGTGCACACCCAGCGGC 0: 1
1: 0
2: 1
3: 11
4: 151
Right 1077142142 11:1029383-1029405 GGGTAGCGGCATGGTGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 296
1077142128_1077142142 8 Left 1077142128 11:1029352-1029374 CCCAGGGTGCACCGGCTGTGGGT 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1077142142 11:1029383-1029405 GGGTAGCGGCATGGTGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077142142 Original CRISPR GGGTAGCGGCATGGTGGGCA GGG Intronic
900087638 1:906022-906044 GGGTGGGGGCTTGGTGGGCCGGG - Intergenic
900143833 1:1149640-1149662 GGGAAGGGGCGTGGTGGGAAGGG + Intergenic
900143848 1:1149675-1149697 GGGAAGGGGCGTGGTGGGAAGGG + Intergenic
900323353 1:2095723-2095745 GGGGAGCGGAAAGGTGGGGAGGG - Intronic
900602900 1:3510682-3510704 TGGTACCCCCATGGTGGGCATGG - Intronic
900667398 1:3824809-3824831 GGGCAGTGGCACGGTGGGAAGGG + Intronic
901519146 1:9769212-9769234 GGGCAGCTGCATGGGGGGGAGGG - Intronic
902838230 1:19060124-19060146 GGGTGGGGGCATGGTGGTCCTGG - Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903781535 1:25823145-25823167 GGGCAGGGGTATGGTGGGGAAGG + Intronic
903792684 1:25905841-25905863 GGGTGGCGGCAGGTTGGGCATGG - Intronic
903847934 1:26289600-26289622 GGGCATCGCCATGATGGGCAGGG - Intronic
904587395 1:31587860-31587882 GGGGAGGGGCATGGATGGCATGG + Intergenic
904985802 1:34547443-34547465 GGGAAGGGGCAGGGAGGGCAGGG + Intergenic
905178916 1:36155153-36155175 GGGCAGGGCCAGGGTGGGCAGGG + Intronic
905975844 1:42173040-42173062 GGGTAGCTGCCCAGTGGGCAAGG + Intergenic
906497644 1:46316849-46316871 GGGGAGCGGCAAGGAGGACAGGG + Intergenic
906940770 1:50253235-50253257 GGGGAATGGCCTGGTGGGCAGGG - Intergenic
908363487 1:63393209-63393231 GGGTGGCGGGATTGGGGGCAGGG - Intronic
910288810 1:85580872-85580894 GGGTGGCGGCGCGGTGGGCCCGG - Exonic
912351482 1:109018254-109018276 GGGTTTCGCCATGTTGGGCAGGG - Intronic
912815500 1:112825106-112825128 GGGTAGAGACATGGCGGGAAGGG + Intergenic
912843520 1:113059739-113059761 GGGTGGGGGCATGAGGGGCATGG + Intergenic
912861517 1:113218063-113218085 GGCTAGCACCATTGTGGGCAGGG - Intergenic
913138636 1:115917463-115917485 GGGTAGGGGCATGGGGAGGAAGG + Intergenic
913283752 1:117209366-117209388 GGCTGGAGGAATGGTGGGCATGG + Intronic
915279710 1:154814076-154814098 AGGGAGGGCCATGGTGGGCATGG + Intronic
916743798 1:167668782-167668804 GGGAAGGTGCATGGTGGGGAAGG + Intronic
917514803 1:175698473-175698495 GGGCAGGGGCAGGGTGGTCAAGG + Intronic
921126110 1:212179569-212179591 GGGTGGTGGCATGGGGGACAGGG - Intergenic
921180763 1:212629691-212629713 GGGTAGAGACTTGATGGGCAAGG + Intergenic
921297645 1:213719738-213719760 GGGCAGTGGCATGGTGGCAAGGG + Intergenic
922726079 1:227923692-227923714 GGTGGGAGGCATGGTGGGCAGGG - Intronic
923342871 1:233022409-233022431 GGGGAGAGGAATGCTGGGCATGG + Intronic
1063501128 10:6555717-6555739 GGGTATGGGCCAGGTGGGCACGG + Intronic
1067708307 10:48627511-48627533 GGTTCAAGGCATGGTGGGCAGGG + Intronic
1069920258 10:71811920-71811942 GGGTTGGGGCATGGAGGGGAGGG - Intronic
1070756730 10:78997989-78998011 GGGTAGTGGCATGGAGGGGCAGG - Intergenic
1071511622 10:86265952-86265974 GGGGAGGTGAATGGTGGGCATGG - Intronic
1072790484 10:98314125-98314147 GGGCAGCTCCATGGTGGGCCTGG + Intergenic
1076501199 10:130937630-130937652 GGGAAGCGGTGTGATGGGCAAGG - Intergenic
1076721396 10:132394971-132394993 GGGCAGAGGGAAGGTGGGCAGGG + Intergenic
1077061593 11:620037-620059 GGGCACCTGCATGGGGGGCAGGG - Intronic
1077142142 11:1029383-1029405 GGGTAGCGGCATGGTGGGCAGGG + Intronic
1077371714 11:2185444-2185466 GGGAGGCAGCATGGAGGGCATGG + Intergenic
1077554261 11:3218394-3218416 GGGCAGCGGCACGGCCGGCAGGG + Exonic
1078424424 11:11237837-11237859 GGGAAGGGGAATGGTAGGCAGGG + Intergenic
1079131207 11:17747852-17747874 GGTGAGTGGCATTGTGGGCAGGG - Intronic
1079407703 11:20160247-20160269 GGGCAGCGTCAAGGTGGGCGTGG + Exonic
1079489517 11:20972024-20972046 GGGGAGCGGGGTGGGGGGCAAGG + Intronic
1081831432 11:46119699-46119721 GGGTAGCAGCAAGGTGGCCCTGG - Intronic
1084195454 11:67521895-67521917 GGGAGGTGGCATGGGGGGCATGG - Intronic
1085505375 11:77055934-77055956 GGGTAGCGGGATCTGGGGCAGGG + Intergenic
1087327958 11:96746624-96746646 GGATCGGGGCATGGTGGGCCAGG - Intergenic
1087599462 11:100293849-100293871 GGGTTGGGGGATGGTGGGCAAGG + Intronic
1088533613 11:110836994-110837016 GGGTATAGTCATGGTGGGGATGG - Intergenic
1088950893 11:114568768-114568790 GGGTAACGGCATGGTGGTGATGG - Intergenic
1088971618 11:114779412-114779434 GGGTGGCTGGATGGTGGGCGAGG + Intergenic
1089049072 11:115530371-115530393 GGGTAGTGGAATGATGGGGAAGG + Intergenic
1090399063 11:126436712-126436734 GGGTGGCTGCAAGGTGGGCCAGG - Intronic
1090797368 11:130146558-130146580 GGCTGGCCGCAAGGTGGGCAGGG - Intergenic
1091551630 12:1539419-1539441 GGGTAGCGGCATGGTCCACCTGG - Intronic
1092279508 12:7089045-7089067 GGGTAGTAGCCTGGTGGCCAGGG + Intronic
1092866249 12:12764153-12764175 GGGTTTCGCCATGTTGGGCAGGG + Intronic
1092925001 12:13264463-13264485 GGGTAGAGACATGGAGGGAAGGG + Intergenic
1095641957 12:44495471-44495493 GGATGGGGGCATGGTGGGCCAGG + Intergenic
1096561680 12:52440056-52440078 GGGTAGGTGCAGGGTGTGCACGG + Intergenic
1097167178 12:57092124-57092146 GGGTAGGGGCCTGTTGGGGAGGG - Intronic
1097185065 12:57192371-57192393 GGGTAGGGGCACCGAGGGCATGG - Intronic
1100699144 12:97127924-97127946 GGCTGGCGGGATGGTGGACAGGG + Intergenic
1101612420 12:106303340-106303362 GGGTAGAGGCAGGGCGGGCCCGG + Intronic
1103779159 12:123388223-123388245 GGGTAGTGGCTGGGAGGGCAAGG + Intronic
1103944339 12:124517845-124517867 GCTCAGCGGGATGGTGGGCAGGG - Intronic
1104415794 12:128595933-128595955 ACTTAACGGCATGGTGGGCATGG - Intronic
1104809452 12:131611700-131611722 GGGTGGGGCCATGCTGGGCAGGG - Intergenic
1105522437 13:21142841-21142863 GGGTACCGGCACACTGGGCATGG - Intronic
1106625146 13:31412950-31412972 GGGAAGGGGCATGGTTGGGAAGG + Intergenic
1108466017 13:50715907-50715929 GGGTAGCAGCAAGGTGTGCCAGG - Intronic
1108709065 13:53015653-53015675 GGGTTGGGGAAAGGTGGGCAAGG - Intergenic
1109104910 13:58238962-58238984 GTTTAGCAGCATGGTGGGCCAGG - Intergenic
1110211173 13:72975245-72975267 GGGTTTCGGCATGGTTGGCCAGG + Intronic
1114050083 14:18914868-18914890 TGGAAGAGGCCTGGTGGGCAGGG + Intergenic
1114112475 14:19487063-19487085 TGGAAGAGGCCTGGTGGGCAGGG - Intergenic
1116121155 14:40723424-40723446 ATGTAGGGGCATGGTGGGCCTGG + Intergenic
1119511558 14:75215545-75215567 GGGCAGGGGCAGGGTGGGCAGGG + Intergenic
1119695420 14:76709529-76709551 GGGAAGCAGCATCGTGGGCTGGG - Intergenic
1119744032 14:77031894-77031916 GGGTAGCGGTAGTGTGGGGAGGG - Intergenic
1119971449 14:78975254-78975276 GTGTAGGGTCATGGTGGTCATGG + Intronic
1119991010 14:79197229-79197251 GGGTAGGTGCATGGTAGTCAGGG + Intronic
1120294491 14:82622812-82622834 GGATGGGGGCATGGTGGGCCAGG + Intergenic
1120745224 14:88146132-88146154 GGATAGGGGCATGGTAGGCCAGG - Intergenic
1122385420 14:101342041-101342063 GGGCTGGGGGATGGTGGGCAGGG - Intergenic
1122814361 14:104305028-104305050 GGGTGGCTGCAAGGTTGGCAGGG + Intergenic
1125839368 15:42784468-42784490 GGGTTTCGCCATGTTGGGCAGGG + Intronic
1128363238 15:66977471-66977493 GGGCAGGGGCATTGTGGGCAGGG - Intergenic
1128608398 15:69055321-69055343 AGGAAGCGGCCTGTTGGGCAGGG - Exonic
1128694614 15:69751390-69751412 GGGAAGTGGCATGATGGGCTTGG + Intergenic
1129591464 15:76918651-76918673 GCTCAGGGGCATGGTGGGCAGGG + Intergenic
1129685647 15:77684845-77684867 TGGCAGCTGCATGGAGGGCAGGG - Intronic
1132569341 16:637253-637275 GGGTTGCGGCAGGGGCGGCAGGG + Intronic
1132695166 16:1198815-1198837 CGTTATCTGCATGGTGGGCAGGG - Intronic
1132779402 16:1614431-1614453 GGGTCCCGGGCTGGTGGGCAGGG + Intronic
1132782178 16:1633330-1633352 AGCTAGCTGCGTGGTGGGCAGGG - Intronic
1132874982 16:2133127-2133149 GGGTCGGGGCAGGGAGGGCAGGG + Intronic
1133003043 16:2860719-2860741 GGATAGCGGCATCTTGGGCAGGG - Intergenic
1134520008 16:14914263-14914285 GGGTCGGGGCAGGGAGGGCAGGG - Intronic
1134553925 16:15151974-15151996 GGGTCGGGGCAGGGAGGGCAGGG + Intergenic
1134707681 16:16312917-16312939 GGGTCGGGGCAGGGAGGGCAGGG - Intergenic
1134959862 16:18399208-18399230 GGGTCGGGGCAGGGAGGGCAGGG + Intergenic
1136240416 16:28939871-28939893 GGGTAGCTGGATGGTGGGAGGGG - Intergenic
1136527120 16:30838588-30838610 GGGTATCGCCATGTTGGCCAGGG - Intronic
1137395960 16:48116316-48116338 GGGGAGCTCCACGGTGGGCAGGG + Intronic
1138542195 16:57695221-57695243 GGGTGGGGGAGTGGTGGGCAAGG - Intronic
1139700267 16:68703752-68703774 GGGTTTCGCCATGTTGGGCAGGG - Intronic
1140450986 16:75070661-75070683 GGGAAGGGGTATGGTGGGCGGGG - Intronic
1141126370 16:81403819-81403841 GTGGAGAGGCATGGTGGGCCGGG + Intergenic
1143104077 17:4519721-4519743 GGATTGCGGGGTGGTGGGCAGGG + Intronic
1143515722 17:7418347-7418369 GGGTAGGGGCAAGGGAGGCAGGG - Exonic
1144322884 17:14147504-14147526 GGGTAGTGGGGTGGTGGGGATGG + Intronic
1144431015 17:15191661-15191683 GGATGGGGGCATGGTGGGCCAGG + Intergenic
1144956378 17:19020913-19020935 TGGTTGAGGGATGGTGGGCAGGG - Exonic
1147659624 17:42110643-42110665 GGGTAGTGGCAGGGCAGGCAGGG + Intronic
1148676431 17:49448287-49448309 CGGCATCGGCATGGTGGGGAAGG - Intronic
1148850788 17:50554119-50554141 GGGAAGGGGCAGGATGGGCAGGG + Intronic
1150640130 17:66943975-66943997 GGGTTTCGGCATGTTGGCCATGG - Intergenic
1150823851 17:68457535-68457557 GGGTAGGGGCGGGGTGGGGACGG - Intergenic
1150823866 17:68457562-68457584 GGGTAGGGGCGGGGTGGGGACGG - Intergenic
1150843139 17:68628119-68628141 GGCTAGTGGGAGGGTGGGCAAGG + Intergenic
1150871442 17:68916126-68916148 GGGTAGTGGGGTGGTGGGGAAGG + Intronic
1151395556 17:73820265-73820287 GGGTGGCGGGCTGCTGGGCAGGG + Intergenic
1151761260 17:76104400-76104422 GGCCAGAGGCAGGGTGGGCAGGG - Intronic
1152225282 17:79090003-79090025 GGGGAGCGGCAGGGAGGGCTGGG + Intronic
1152538372 17:80963098-80963120 GGGTAGAGGGATGGGAGGCAAGG + Intronic
1152572004 17:81125031-81125053 GGGCAGGGGCAGGGTGAGCAGGG + Intronic
1152644573 17:81462895-81462917 GGGCAGCAACATGGTGGTCAAGG + Exonic
1153912090 18:9713302-9713324 GGGAAGGGGGATGGTGGGGAGGG + Intronic
1155173663 18:23285244-23285266 GGGTAGAGACATGGAGGGAAGGG - Intronic
1156135478 18:34032334-34032356 GGGTGTCAGCATGGTAGGCAGGG - Intronic
1156301582 18:35841067-35841089 GGGTAGGGGCTTGGGGAGCAGGG - Intergenic
1157972722 18:52288696-52288718 GGGTAGGGGGATGGTGGAGAAGG + Intergenic
1158626773 18:59078426-59078448 GGGAGGTGGCATGGTGGGAATGG + Intergenic
1160777385 19:862360-862382 GGGTTGGGGCATGAGGGGCAGGG + Intronic
1160833953 19:1115993-1116015 GGGTGGGGCCATGGGGGGCAGGG + Intronic
1161191572 19:2960096-2960118 GGGCAGCGAGATGGGGGGCAGGG + Intergenic
1161425633 19:4201273-4201295 GGTCACAGGCATGGTGGGCAGGG + Intronic
1162053674 19:8050431-8050453 GGGAAGCGGCGTGGCGGGCTGGG - Intronic
1162123308 19:8485664-8485686 GGGTGCCGGCATGGAGCGCATGG + Exonic
1162779169 19:12997662-12997684 GGCTGGCAGCCTGGTGGGCAAGG - Intronic
1165136504 19:33673178-33673200 GGGAAGCTGCTTGGCGGGCACGG - Intronic
1165432857 19:35782292-35782314 GGGTAGGGGCAAGGGGAGCATGG + Intronic
1165776191 19:38405628-38405650 GGGCAGAGGTGTGGTGGGCAGGG + Exonic
1166255595 19:41601972-41601994 GGGTTGAGGCATCTTGGGCAGGG + Intronic
1167166886 19:47804620-47804642 GGGTCCCGGCAGGGTGGGCCAGG - Intronic
1167748809 19:51367964-51367986 GGGTGTCGGCGTGGTGGGCATGG - Exonic
1168408177 19:56121345-56121367 GGGTGGCGGCCCGGGGGGCAGGG - Intergenic
1168512758 19:56986694-56986716 GGTTTGAGGCATGGTGGCCACGG + Intergenic
925420313 2:3704727-3704749 GGGGAGGGGCGTGGGGGGCAGGG + Intronic
925939192 2:8799134-8799156 GGGCAGTGGGATGGTAGGCATGG - Intronic
926799387 2:16646240-16646262 GGGTAGTGGCCTGGTGGGGGAGG - Intronic
929981402 2:46683638-46683660 GGGCAGAGGTATGGTGGGAAGGG + Intergenic
932090325 2:68800229-68800251 GGCTAGAGGCAGGGTGGGGAGGG + Intronic
932577069 2:72968474-72968496 GGGTAGCACCAGGATGGGCATGG + Exonic
932702745 2:74002519-74002541 GGGGAGCGGCACGGCGGGCCTGG + Intronic
937117837 2:119421461-119421483 GGGAAGTGGCATCCTGGGCATGG + Intergenic
937218466 2:120327574-120327596 GGGCTGGAGCATGGTGGGCAAGG - Intergenic
938288112 2:130135666-130135688 TGGAAGAGGCCTGGTGGGCAGGG - Intergenic
938427472 2:131203226-131203248 TGGAAGAGGCCTGGTGGGCAGGG + Intronic
938468417 2:131537274-131537296 TGGAAGAGGCGTGGTGGGCAGGG + Intergenic
940071454 2:149692680-149692702 GGGTGCTGGCATGGTGGGCAGGG + Intergenic
940471308 2:154104201-154104223 GGGTGGGGGGATGGTGGGGAGGG + Intronic
946044446 2:216809991-216810013 GGGTGGTGACATGGGGGGCACGG + Intergenic
948862880 2:240761421-240761443 AGGGCGGGGCATGGTGGGCAGGG - Intronic
948951562 2:241255623-241255645 GGGAAGCGGGCAGGTGGGCATGG + Intronic
1169832385 20:9838878-9838900 GGGTAGGGGCAAGGGGGGCGGGG + Exonic
1170486019 20:16816954-16816976 GGATGGGGGCATGGTGGGCCAGG + Intergenic
1170533081 20:17314043-17314065 GGGTAGGGACATGGTGGGTGGGG - Intronic
1172870443 20:38132319-38132341 GGGTAAGGGCAGGCTGGGCAAGG - Exonic
1172995932 20:39070441-39070463 GGGTAGGGGCTTGGAGGGGAGGG - Intergenic
1175835205 20:61989307-61989329 GGGAAGCTGCAGAGTGGGCAGGG + Intronic
1175911749 20:62408376-62408398 GGGTAGGGGCCTGAAGGGCAGGG - Intergenic
1176975450 21:15315736-15315758 GGGTAGTGGCATGGATGGAAAGG - Intergenic
1180091298 21:45535003-45535025 GGGAGGCGGGAAGGTGGGCAAGG + Intronic
1180468563 22:15637243-15637265 TGGAAGAGGCCTGGTGGGCAGGG + Intergenic
1181483969 22:23219032-23219054 GGGCAGCGGCATGGCAGGAATGG - Intronic
1181771533 22:25129147-25129169 TGGTGGCGGCATGGTGGGCGGGG + Intronic
1181964267 22:26645555-26645577 GGGTAGAGGGATGGTGGAAAGGG + Intergenic
1182555523 22:31126584-31126606 GGGTGGGGGCAGGGTGGCCATGG - Intronic
1183032905 22:35118752-35118774 GGGTACTGGCTGGGTGGGCACGG + Intergenic
1183132369 22:35851066-35851088 GGGGCGGGGCATGGAGGGCATGG - Intronic
1183411029 22:37655290-37655312 GGGGGGCGGCATGGTGGGCCGGG - Exonic
1183730812 22:39617474-39617496 GGGGTGGGGCATGGTGGGGAGGG + Intronic
1185150643 22:49161879-49161901 GTGTAGCGGCGTGCTGGCCAGGG - Intergenic
1185345287 22:50308046-50308068 GGACGGCGGCATGGTGGGCAGGG - Intergenic
949131408 3:506282-506304 GGGTAGGGGGGTGGTGGGCAGGG - Intergenic
952978161 3:38713818-38713840 GGGTTTCGGCATGTTGGCCAGGG + Intronic
953013633 3:39052164-39052186 GGGTAGCGGCATGGGGCGAACGG + Intronic
953614414 3:44477539-44477561 GGGTGGCGGCATTGCGGGCGCGG - Intronic
954359969 3:50116476-50116498 GGTTGGCGGCCAGGTGGGCAGGG + Intronic
954416953 3:50397984-50398006 GGGGTGGGGCAGGGTGGGCACGG - Intronic
958920482 3:100100132-100100154 TGGAAGTGGCATGGTGGGCTGGG + Intronic
960096291 3:113693332-113693354 GGTTAGCAGTATGGTGGGGAAGG + Intronic
961280939 3:125765688-125765710 GGGCTGGAGCATGGTGGGCAAGG - Intergenic
962095164 3:132285456-132285478 GGATGGGGGCATGGTGGGCCAGG + Intergenic
963768262 3:149361474-149361496 GAGTAGAGGCATGGGCGGCAAGG - Intergenic
963908295 3:150792330-150792352 GGAAAGCAGCGTGGTGGGCAGGG + Intergenic
965075603 3:163971167-163971189 GGGTAGTGGGAGGGTGGGGATGG - Intergenic
966786821 3:183629933-183629955 GGGTAGGGGTGGGGTGGGCAGGG + Intergenic
967921188 3:194615760-194615782 GGGTGGCAGCATGGTGTGGAGGG - Intronic
968134203 3:196209605-196209627 GGGTGGGGACAAGGTGGGCAGGG + Intronic
968229579 3:196997437-196997459 GGGGAGCCGCATGCTGGGAAAGG + Intronic
968493509 4:903144-903166 GTGTGGCGGTGTGGTGGGCAGGG + Intronic
968534217 4:1113299-1113321 GGGGAGCGGCAAGGGGGTCAGGG - Intronic
968626565 4:1628723-1628745 GGGGAGTGGCATGGGGGGGAGGG + Intronic
968647960 4:1749350-1749372 GGGAGGGGGCATGGTGGGGAGGG - Intergenic
968651249 4:1761125-1761147 GGGCAGCTGCATGGTGGGAGGGG - Intergenic
969208755 4:5670057-5670079 GAGTAGAGGCATTGTAGGCAGGG - Intronic
969493415 4:7512653-7512675 GGGGAGGGGTATGGTGGGGAGGG - Intronic
969642933 4:8409987-8410009 GGCTATCTGCATTGTGGGCAGGG + Intronic
970524630 4:16918938-16918960 GGGCAGGGGCAAGGTGGGGAGGG - Intergenic
977472192 4:97455346-97455368 GGTTGGAGGCATGGTGGGCCAGG - Intronic
977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG + Intergenic
981491196 4:145341376-145341398 AGGAAGGGACATGGTGGGCAAGG + Intergenic
985926924 5:3026265-3026287 AGGGAGAGGCAGGGTGGGCAGGG - Intergenic
986292494 5:6411354-6411376 GGGCTGCGGCATGATGGGCCTGG + Intergenic
988514324 5:31891640-31891662 GAGAAGTGGCATTGTGGGCAGGG + Intronic
989617943 5:43356298-43356320 GGGTAGGGGCAGGGAGGGTAGGG - Intergenic
992906610 5:81352609-81352631 GGGTAGTGGGAGGGTGGGGATGG + Intronic
995181455 5:109234439-109234461 GGGGAGCGACAGGGAGGGCAGGG + Intergenic
997267482 5:132503560-132503582 TGGCTGCAGCATGGTGGGCAAGG + Intergenic
997405126 5:133639648-133639670 TGGAAGCCCCATGGTGGGCAGGG + Intergenic
997585099 5:135039307-135039329 GGGTAGCAGCCTCGGGGGCACGG - Intronic
999093663 5:148958960-148958982 GGGTGGTGGCAGGGAGGGCAGGG - Intronic
999242980 5:150138273-150138295 AGGTAGGGGCAAGCTGGGCATGG - Intronic
999302991 5:150502519-150502541 GGGGAGGGGCATGGTGCACATGG + Intronic
1001587680 5:172844555-172844577 GGGAGGTGGCCTGGTGGGCATGG + Intronic
1001854504 5:174999365-174999387 GTGCAGAGGCATGGAGGGCATGG - Intergenic
1002535705 5:179874300-179874322 GGGAAAGGGCATGGTGGGCCTGG + Intronic
1002820510 6:720249-720271 GGGCAGTGGGATGGTGGGAAGGG + Intergenic
1004396152 6:15248235-15248257 GGGTCGCGGCAGGCTGGGCCGGG + Intronic
1005374699 6:25170391-25170413 GGTCAGGTGCATGGTGGGCAGGG + Intergenic
1006300231 6:33190199-33190221 GGGTGGAGGAATGGGGGGCAGGG + Intronic
1006375687 6:33670584-33670606 GGGTGGAGGCAGGGTGGGCGGGG + Intronic
1007156716 6:39752352-39752374 GGGTAGCTCCATGATGGCCAGGG - Intergenic
1008076001 6:47146885-47146907 GGGAAGCAGTGTGGTGGGCAGGG + Intergenic
1014611895 6:123557754-123557776 GGGTAGAGACATGGAGGGAAGGG - Intronic
1015436892 6:133200006-133200028 GTGCAGTGGCATGGTGGTCACGG + Intergenic
1015465362 6:133542903-133542925 GGGCAGTGGCAATGTGGGCAGGG + Intergenic
1015735655 6:136397490-136397512 GGGTGGGGGCAAGGTGGGCGGGG - Intronic
1017643475 6:156516731-156516753 GGGCAGGGGCAGGGTGGGGAAGG - Intergenic
1019136664 6:169912813-169912835 GGGAAGCAGCATTTTGGGCACGG - Intergenic
1022481227 7:30744340-30744362 GGGTGGTGGGATGGTGGGAAAGG - Intronic
1022876994 7:34544595-34544617 GGATGGGGGCATGGTGGGCCAGG - Intergenic
1024014875 7:45304629-45304651 GGCTAGGGGCAAGGTGGGGATGG - Intergenic
1024352064 7:48376812-48376834 GGGGAGCTGCTTGGTGGGCCTGG - Intronic
1025820141 7:64955294-64955316 GGATGGGGGCATGGTGGGCCAGG - Intergenic
1026166723 7:67916683-67916705 GGGTTGGGGGATGGGGGGCAAGG - Intergenic
1026859792 7:73778379-73778401 GGGGAGAGGCATGGTGCGCTGGG - Intergenic
1027707726 7:81555276-81555298 GGGTAGCGTCTTGATGGCCAGGG - Intergenic
1030219148 7:107078888-107078910 AGGTTGGGGCATGGTGGGAAGGG + Intronic
1031665472 7:124477987-124478009 GTGTTGGGCCATGGTGGGCATGG - Intergenic
1032428675 7:131842956-131842978 GGCTAGAGGCATTGTGGGCTCGG + Intergenic
1034275403 7:149821778-149821800 GGGGACCTGCATGGTGGCCAAGG - Intergenic
1034889747 7:154829439-154829461 GGGGAGGGGAATGGTGGGGAGGG + Intronic
1035358780 7:158296144-158296166 GGATAGAGGCATGGTGGACCAGG - Intronic
1035692264 8:1568048-1568070 GGGCAGTGGCATGGGGGCCATGG - Intronic
1035692386 8:1568692-1568714 GGGCAGTGGCATGGGGGCCACGG - Intronic
1035692462 8:1569089-1569111 GGGCAGTGGCATGGGGGCCACGG - Intronic
1035692474 8:1569138-1569160 GGGCAGTGGCATGGGGGCCACGG - Intronic
1035714137 8:1740928-1740950 GGGAAGCCCCATGGTGGGCTGGG - Intergenic
1036258484 8:7222820-7222842 GGGCTGGAGCATGGTGGGCAAGG + Intergenic
1036308136 8:7616688-7616710 GGGCTGGAGCATGGTGGGCAAGG - Intergenic
1036310539 8:7681416-7681438 GGGCTGGAGCATGGTGGGCAAGG + Intergenic
1036358992 8:8064689-8064711 GGGTTGGAGCATGGTGGGCAAGG - Intergenic
1038786912 8:30625887-30625909 GGATAGTGGCAGGCTGGGCACGG - Intronic
1038965274 8:32565119-32565141 GGGAATGGGAATGGTGGGCAGGG - Intronic
1040782109 8:51121734-51121756 GGATAGGGGCATGATGGGCAAGG - Intergenic
1040787343 8:51181349-51181371 GGATGGGGGCATGGTGGGCCAGG - Intergenic
1040902782 8:52433946-52433968 GTAAAGCGCCATGGTGGGCAGGG - Intronic
1041934667 8:63322187-63322209 GGATGGGGGCATGGTGGGCCAGG - Intergenic
1046557601 8:115794139-115794161 GGGTAGTGGGGTGGTGGGGATGG + Intronic
1047684501 8:127291093-127291115 GGGTTGCTGAATGGTGGGGATGG - Intergenic
1048515457 8:135105270-135105292 GGCTAGGGGGATGGTGGGAATGG - Intergenic
1049014223 8:139908238-139908260 GGGCAGGTGCATGGTGGGCCTGG - Intronic
1049630172 8:143649758-143649780 GGGTAGCAGCATGTTGGGTCAGG + Exonic
1049771306 8:144383255-144383277 GGGTTGCGGCGTGGCGGGCGGGG + Intronic
1050342524 9:4654819-4654841 GGATGGGGGCATGGTGGGCCAGG + Intronic
1050458147 9:5853658-5853680 GGGTAGTGGGAGGGTAGGCACGG - Intergenic
1050473943 9:6020958-6020980 GGGTAGGGACATGGAGGGAAGGG - Intergenic
1052778457 9:32756073-32756095 GGGTGGAGGCATGGCGGGCCAGG + Intergenic
1053174437 9:35911882-35911904 GGGGAGGAGCATGGTGGGCGAGG + Intergenic
1056119499 9:83473217-83473239 GGGAAGAGGCAAGGTGGGCCAGG - Intronic
1056513983 9:87333051-87333073 GGGCAGAGGGCTGGTGGGCATGG - Intergenic
1057199448 9:93132560-93132582 GGGGCGGGGCATGGTGGTCAGGG - Intronic
1057226350 9:93295279-93295301 GGGGAGCGGCTGCGTGGGCAGGG - Intronic
1058263957 9:102874211-102874233 GGGGAACGGCCTGGTGGGCCTGG + Intergenic
1061033344 9:128100020-128100042 GGGTGGCGGCAGGATGTGCAGGG + Intronic
1061098353 9:128473091-128473113 GGGCAGCTGCAGGCTGGGCAGGG + Intronic
1061218352 9:129234998-129235020 GGGTGGGGGCAGGGTGGGCAGGG - Intergenic
1061226798 9:129285060-129285082 GGGTGGGGACATGGTGGGAAGGG + Intergenic
1062453958 9:136627120-136627142 GGGGGGCGGCGAGGTGGGCAGGG - Intergenic
1062501855 9:136855138-136855160 GGGGAGCCGCACTGTGGGCAGGG + Intronic
1062665068 9:137666159-137666181 GGCAAGCGGCATGGAGGACAAGG - Intronic
1203565614 Un_KI270744v1:85009-85031 GGGTAGGGGCAAGCAGGGCAGGG - Intergenic
1186761686 X:12729755-12729777 GGGAAGAGCCTTGGTGGGCATGG - Intergenic
1188037850 X:25338490-25338512 GGGTGGCGGATTGGGGGGCAGGG - Intergenic
1193580766 X:83260090-83260112 GGGAAGCTGCAATGTGGGCAGGG - Intergenic
1194298242 X:92154563-92154585 GGATGGAGGCATGGTGGGCCAGG - Intronic
1197082888 X:122440525-122440547 GGGCAGCAGCTTGGTGGGCCTGG + Intergenic
1197700847 X:129598294-129598316 GGGGAGGGGGGTGGTGGGCAGGG - Intergenic
1198027846 X:132726028-132726050 GGGTAGGGGGAAGGTGGGGATGG + Intronic
1198305619 X:135379790-135379812 GGCTAGAGACATGGTGGGAAAGG - Intergenic
1200229597 X:154437424-154437446 GGGGAGCAGCGGGGTGGGCACGG - Intronic
1200615851 Y:5379523-5379545 GGATGGAGGCATGGTGGGCCAGG - Intronic