ID: 1077143026

View in Genome Browser
Species Human (GRCh38)
Location 11:1033195-1033217
Sequence TCCATGGCCCGTGGGGCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077143017_1077143026 13 Left 1077143017 11:1033159-1033181 CCCGTTTCCCTGCACACACTCGG 0: 1
1: 0
2: 2
3: 10
4: 140
Right 1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG 0: 1
1: 0
2: 1
3: 8
4: 136
1077143016_1077143026 16 Left 1077143016 11:1033156-1033178 CCGCCCGTTTCCCTGCACACACT 0: 1
1: 0
2: 0
3: 19
4: 297
Right 1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG 0: 1
1: 0
2: 1
3: 8
4: 136
1077143021_1077143026 5 Left 1077143021 11:1033167-1033189 CCTGCACACACTCGGCGTGCGAG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG 0: 1
1: 0
2: 1
3: 8
4: 136
1077143020_1077143026 6 Left 1077143020 11:1033166-1033188 CCCTGCACACACTCGGCGTGCGA 0: 1
1: 0
2: 0
3: 0
4: 56
Right 1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG 0: 1
1: 0
2: 1
3: 8
4: 136
1077143019_1077143026 12 Left 1077143019 11:1033160-1033182 CCGTTTCCCTGCACACACTCGGC 0: 1
1: 0
2: 0
3: 20
4: 220
Right 1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG 0: 1
1: 0
2: 1
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077143026 Original CRISPR TCCATGGCCCGTGGGGCTCG AGG Intronic