ID: 1077143026

View in Genome Browser
Species Human (GRCh38)
Location 11:1033195-1033217
Sequence TCCATGGCCCGTGGGGCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077143017_1077143026 13 Left 1077143017 11:1033159-1033181 CCCGTTTCCCTGCACACACTCGG 0: 1
1: 0
2: 2
3: 10
4: 140
Right 1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG 0: 1
1: 0
2: 1
3: 8
4: 136
1077143019_1077143026 12 Left 1077143019 11:1033160-1033182 CCGTTTCCCTGCACACACTCGGC 0: 1
1: 0
2: 0
3: 20
4: 220
Right 1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG 0: 1
1: 0
2: 1
3: 8
4: 136
1077143020_1077143026 6 Left 1077143020 11:1033166-1033188 CCCTGCACACACTCGGCGTGCGA 0: 1
1: 0
2: 0
3: 0
4: 56
Right 1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG 0: 1
1: 0
2: 1
3: 8
4: 136
1077143021_1077143026 5 Left 1077143021 11:1033167-1033189 CCTGCACACACTCGGCGTGCGAG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG 0: 1
1: 0
2: 1
3: 8
4: 136
1077143016_1077143026 16 Left 1077143016 11:1033156-1033178 CCGCCCGTTTCCCTGCACACACT 0: 1
1: 0
2: 0
3: 19
4: 297
Right 1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG 0: 1
1: 0
2: 1
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077143026 Original CRISPR TCCATGGCCCGTGGGGCTCG AGG Intronic
900288031 1:1911079-1911101 ACCAGGGCAGGTGGGGCTCGGGG + Intergenic
901304469 1:8222833-8222855 TCCATGGCCCAGGGGGGTTGGGG - Intergenic
902077893 1:13802155-13802177 ACCATGGCCTGTGGAGCTGGAGG - Intronic
902603118 1:17553424-17553446 TCTATTGCCTGTGGGACTCGAGG + Intronic
902818419 1:18929067-18929089 TCTAAGGCCTGCGGGGCTCGTGG - Intronic
903543288 1:24108578-24108600 TCCATGGCCTGGGGGGGCCGGGG + Exonic
906719769 1:47996793-47996815 GCCAGGGCCCGCGGGGCGCGGGG + Exonic
915168592 1:153962631-153962653 TCCAGTGCCTGTGGGGCTGGAGG - Exonic
923882253 1:238116557-238116579 ACCATGGGCCGTGGGGATGGTGG + Intergenic
1064130289 10:12703392-12703414 CCCATGGCCTGTGGGTCTGGTGG - Intronic
1064398780 10:15003091-15003113 TCTATGGCCTGGGGGGCTCAAGG + Intergenic
1069545828 10:69327970-69327992 TCCATGGCCCCTGGTGCTGTGGG + Intronic
1070742859 10:78913841-78913863 ACAATGGCCCGGGGGGCTGGCGG + Intergenic
1073487829 10:103832071-103832093 TCCATGGTCCCTGGGGCATGGGG - Intronic
1074298135 10:112209902-112209924 CCCATGCCCTGTGGGGCTGGCGG - Intronic
1074568182 10:114600558-114600580 TCCATGGCCACGGGGGCTCTTGG - Intronic
1076731413 10:132440856-132440878 GCCATGGACAGTGGGGCTCAGGG - Intergenic
1076735886 10:132458746-132458768 CCCATGGGGCGTGGGGCTCAGGG - Intergenic
1077060847 11:617310-617332 TCCAGTGCCCGTGCGGCTGGGGG + Exonic
1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG + Intronic
1077317902 11:1927437-1927459 TTCATGGGCCGTGGGGCTGAGGG + Intronic
1083595227 11:63915814-63915836 GCCATGGCCATTGGGGCTGGAGG + Intronic
1083595447 11:63916640-63916662 GCCCTGGCTCGTGGGGGTCGTGG - Exonic
1083707951 11:64529684-64529706 TCCATGGCAGCTGGGGCTTGAGG - Intergenic
1083997187 11:66278345-66278367 GGCATGGCCCGTGGGGCTCGGGG - Exonic
1084010841 11:66347541-66347563 TGCATGGCTCTCGGGGCTCGGGG + Exonic
1084220396 11:67674319-67674341 CCCATGGCCCGTGGGTCAGGGGG - Intronic
1085350308 11:75793961-75793983 TCCATAGCTAGTGGGGCTCGGGG - Intronic
1085626562 11:78078409-78078431 TTCTAGGCCCGTGGGGCTAGTGG - Intronic
1086329902 11:85743699-85743721 TTCATGAACCGTGGGGCTGGTGG - Intronic
1086443691 11:86852310-86852332 TCTATGGCCTGTGGGGCTCAGGG + Intronic
1090799145 11:130159902-130159924 CCCATGGCCCGCAGGGCGCGGGG - Exonic
1091285454 11:134406086-134406108 ACCAGCGCCCGGGGGGCTCGTGG + Intronic
1092431222 12:8410466-8410488 TCTGTGGCCTGTGGGGCTCAAGG + Intergenic
1092434124 12:8432659-8432681 TCTGTGGCCTGTGGGGCTCAAGG + Intergenic
1096244051 12:49974572-49974594 TCCAAGGCACGAGGGGCTCAGGG - Intronic
1096507497 12:52104296-52104318 TCTATGGCCTGGGGGGCTCAAGG - Intergenic
1099025071 12:77455116-77455138 TCCCTGGCCCCTGGGGATTGGGG + Intergenic
1102046536 12:109833262-109833284 TCCGTGGCCCGTCCGGCTCCGGG - Intronic
1104276450 12:127333082-127333104 TCCATGGACCCTGGGGCTTGAGG + Intergenic
1105026640 12:132853466-132853488 CCCAGGGCCTGTGGGGCTCCTGG + Exonic
1108778480 13:53797044-53797066 CCCATGGCACGTGGGAATCGTGG + Intergenic
1114598135 14:23931807-23931829 TCCATGGACTGTGGGGTTTGCGG - Intergenic
1116614848 14:47121999-47122021 TGCATGGACCTTGGGGCTCAAGG + Intronic
1117040787 14:51767032-51767054 TCTATGGCCTGGGGGGCTCAAGG + Intergenic
1118370095 14:65130466-65130488 TCCATGGACAGTGGGGGTAGGGG + Intergenic
1121613811 14:95299396-95299418 TGCGTGTCCCGTGGGGCTGGAGG - Intronic
1122028469 14:98895071-98895093 TGCATGGCCCAGGGGGCTCTGGG + Intergenic
1124848280 15:33311758-33311780 TCCCTGTCCTGCGGGGCTCGCGG - Intronic
1132360851 15:101214049-101214071 TCCATCACCTGTGGGGCTGGTGG + Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132701811 16:1225233-1225255 ACCATGGCCCTTGGGGCCTGTGG - Exonic
1134872383 16:17663672-17663694 TAGATGGCCCCTGGGGCTTGCGG - Intergenic
1136029197 16:27490425-27490447 GGCATGGCCGGTGGGGCCCGGGG + Intronic
1137568452 16:49549185-49549207 TCCTGGGGCCGTGGGGCTCTTGG + Intronic
1138084581 16:54122083-54122105 TCCATGGACGGCGGGGCTCCCGG - Intergenic
1138084594 16:54122131-54122153 TCCATGGACGGCGGGGCTCAGGG - Intergenic
1138084608 16:54122179-54122201 TCCATGGACGGCGGGGCTCAGGG - Intergenic
1138084622 16:54122227-54122249 TCCATGGACGGCGGGGCTCAGGG - Intergenic
1138093389 16:54194338-54194360 GCCATGGCCCGTGTGGCCCGGGG - Intergenic
1138506160 16:57479348-57479370 GGCATGGCGCGTGGGGCACGCGG - Intronic
1144727301 17:17508258-17508280 TCCATGGCCGGTGAGCCTGGGGG + Intronic
1145997104 17:29111136-29111158 GACAGGGCCCGTGGGGCTGGGGG + Intronic
1146122128 17:30204954-30204976 TCCATGTGCCCTGGGGCTTGGGG - Intronic
1146846231 17:36183452-36183474 TCCATGGGGCTCGGGGCTCGGGG - Intronic
1148110687 17:45143469-45143491 GCCATGGCCCCTTGGGCTCCCGG + Exonic
1148559558 17:48598012-48598034 GCCCTGGCCCGTAGGGCGCGGGG + Exonic
1152124248 17:78437004-78437026 TGCCTGGCACCTGGGGCTCGAGG - Intronic
1158132368 18:54166824-54166846 TCCATAGCCCCTAGGGCACGAGG - Intronic
1161261595 19:3340785-3340807 CCCATGGGCCCTGGGGCTCCAGG - Intergenic
1162216679 19:9140433-9140455 TCCTTGGCCCATGTGTCTCGGGG - Exonic
1162341131 19:10092065-10092087 TCCCAGGCACGTGGGGCTCTAGG - Exonic
1162746945 19:12804119-12804141 TCCTTGGCCCGTGGGGAAAGTGG + Intronic
1163397222 19:17070683-17070705 TCCTGGGCCCCTGGGGCTCTAGG - Intronic
1164951837 19:32343783-32343805 TCCATTGACCCTGTGGCTCGGGG - Intergenic
1165169489 19:33881448-33881470 ACCCTGGCCAGTGGGGCTGGAGG - Intergenic
1166331558 19:42080719-42080741 CGAGTGGCCCGTGGGGCTCGAGG - Exonic
1168314641 19:55479272-55479294 TCCATGGCCTGGGCGGCGCGTGG - Intronic
926984794 2:18611062-18611084 CCCATGGCCCCTGTGTCTCGAGG + Intergenic
928373382 2:30757130-30757152 ATCATCGCCCGTGGGGCTGGGGG - Intronic
932351317 2:71034676-71034698 TCTATGGCCTGGGGGGCTCAAGG - Intergenic
932819536 2:74887668-74887690 CCCGAGGCCCGTGGGGCTCCTGG - Intronic
936166495 2:110124624-110124646 ACCATGGCCTGTGGGCATCGGGG - Intronic
936533829 2:113295561-113295583 TACATGGACCTTGGGACTCGGGG - Intergenic
936624608 2:114135338-114135360 TCCATGGCCCATGGGACTGATGG + Intergenic
937867687 2:126766380-126766402 GCCATGGCCTGTGGTGCTCCTGG + Intergenic
939710602 2:145513821-145513843 TCCATGGCCCATTGGCCTTGTGG - Intergenic
942318446 2:174715149-174715171 TCCATGACCCTGGGGGCTCCAGG + Intergenic
947896225 2:233675464-233675486 TCCATGGCAGGTGCGGCTCTGGG + Intronic
948173895 2:235928394-235928416 TCCTTGGCCCTTGGGGCCCATGG - Intronic
1169072980 20:2745028-2745050 TTCATGCCGCGTGGGGCTGGTGG + Intronic
1171884537 20:30642473-30642495 TCCATGACTCTTGGGGCTGGAGG - Intergenic
1179879735 21:44288404-44288426 TCCACGGCCCCTCGGGCTCCCGG - Exonic
1179906436 21:44425533-44425555 TGCATGGCCATTTGGGCTCGGGG + Intronic
1183069755 22:35387791-35387813 GCCATGGGGCCTGGGGCTCGGGG + Intronic
1183190368 22:36318578-36318600 TCTCTGCCCCGTGGGGCTCAGGG - Intronic
1183504622 22:38202329-38202351 TCCATCGCCCGGACGGCTCGGGG + Intronic
1184002865 22:41688270-41688292 TCCCTGGCGCGTGTGACTCGCGG + Intronic
1184403107 22:44285488-44285510 TGCACGGCCTGTGGGGCTTGTGG + Exonic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
1185205253 22:49534142-49534164 TCCATGGTCCCTGCGGCTCAGGG - Intronic
1185385945 22:50531399-50531421 TCAAAGCCCCGTGGGGTTCGGGG + Intronic
949105667 3:197671-197693 TCCATGGACCGTGGGGTTGTGGG + Intronic
949885915 3:8693897-8693919 TCTATGGCCCGGGGGGCTCAAGG - Intronic
950371082 3:12531177-12531199 TCCATGACACGTGGGGATTGTGG + Intronic
952536062 3:34310259-34310281 TCCAGGGCCCGGGAGGCTCTGGG + Intergenic
954124428 3:48520355-48520377 TCCTTGGCCTGTCGGGCTCAGGG + Intronic
954292376 3:49656418-49656440 GCCAAGGCCCCTGGGGCTGGGGG + Exonic
954937358 3:54338798-54338820 GCCCTGGCTCGTGGGGCTTGAGG + Intronic
955753921 3:62208945-62208967 GCCATGGGCCGTGTGGCTCTGGG - Intronic
957043081 3:75351768-75351790 TCTATGGCCTGGGGGGCTCAAGG + Intergenic
966809147 3:183827969-183827991 TCCCTGGCCCGTGGGCCTCTTGG - Intergenic
969026612 4:4178050-4178072 TCTATGGCCTGGGGGGCTCAAGG + Intergenic
969441490 4:7219719-7219741 CCCATGACACGTGGGGATCGTGG + Intronic
975823082 4:78291270-78291292 TCCATGGACCGGGGAGCTGGGGG + Intronic
986140492 5:5025618-5025640 TCCATGCCCTGTGTGGCTCTCGG - Intergenic
993650244 5:90511134-90511156 TCCAAGGCACATGGGGCACGGGG - Intronic
996389404 5:122943513-122943535 TCCATCTCACGTGAGGCTCGGGG + Intronic
1002541119 5:179907383-179907405 TGCACGGCCCCCGGGGCTCGCGG + Intronic
1006211022 6:32394921-32394943 TCCATGGCACGTGGGGCTGTGGG + Exonic
1006393111 6:33770536-33770558 GCCATGCCCCATGGGGCTTGTGG - Intergenic
1007257650 6:40540047-40540069 TCCATGGCCTGTGCGGCGCCAGG - Intronic
1008654765 6:53600647-53600669 ACCATGGCCTGTGGGACTAGGGG + Intronic
1012125848 6:95427483-95427505 TCCATGACTCGTGGGGATTGTGG - Intergenic
1014638032 6:123873183-123873205 TCCATGGCGGGTGGGGGTGGGGG - Intronic
1018045821 6:159965575-159965597 TCCATGGCCCGGAGGGTTGGGGG - Intergenic
1018794803 6:167177470-167177492 GCCATGGCCCGTGCGTCTGGGGG + Intronic
1018821515 6:167377597-167377619 GCCATGGCCCGTGCGTCTGGGGG - Intronic
1019275539 7:173641-173663 TCCAGGGGCCATGGGGCCCGGGG + Intergenic
1021092205 7:16496829-16496851 CCCATGACCTGTGGGGCTCATGG + Intronic
1029711706 7:102303509-102303531 TCCAGGGCCCATGTGGCTCATGG - Intronic
1036818950 8:11923783-11923805 TCTATGGCCTGGGGGGCTCAAGG + Intergenic
1038345057 8:26725093-26725115 CCCATGACACGTGGGGATCGTGG - Intergenic
1045090118 8:98733308-98733330 TCCATGGCCCGTTGGGAACTGGG + Intronic
1049426115 8:142538609-142538631 TCCAGGGGCCCTGGGGCTCCAGG - Intronic
1057187142 9:93063224-93063246 TCCATGGACCTTGGGGATTGAGG + Intronic
1057429292 9:94979732-94979754 TCCATGCCCCGTGGGGCAGGTGG + Intronic
1057915367 9:99051298-99051320 ACCATGGCCTTTGGGGGTCGTGG + Intronic
1058707345 9:107648308-107648330 GCCATGGGCCGTGGGTCTGGAGG - Intergenic
1060237888 9:121878893-121878915 TCCCTGGGCTGTGGGGCTGGTGG + Intronic
1061216000 9:129222406-129222428 TCCAAGGCAGGTGGGGCTGGCGG - Intergenic
1062165031 9:135103395-135103417 CCCAGGGCCCTTGGGGCTGGAGG - Intronic
1203759515 EBV:4869-4891 TTCATGGCCCCTGGTGCCCGGGG - Intergenic
1189462473 X:41253557-41253579 ACCTTGACCCGTGGGGGTCGTGG + Intergenic
1198035395 X:132796685-132796707 TCCATGGCAAGTGGAGCTCTGGG + Intronic
1200083604 X:153591911-153591933 TCCCTGGCCCGTGTGCCTTGTGG - Intronic