ID: 1077152182

View in Genome Browser
Species Human (GRCh38)
Location 11:1077364-1077386
Sequence CCGGGACCCCGCCGCCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077152182_1077152194 -3 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152194 11:1077384-1077406 CGGGAGGACAAGCTGGGGCGGGG No data
1077152182_1077152195 -2 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152195 11:1077385-1077407 GGGAGGACAAGCTGGGGCGGGGG No data
1077152182_1077152188 -9 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152188 11:1077378-1077400 GGGTCCCGGGAGGACAAGCTGGG No data
1077152182_1077152193 -4 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152193 11:1077383-1077405 CCGGGAGGACAAGCTGGGGCGGG No data
1077152182_1077152187 -10 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152187 11:1077377-1077399 GGGGTCCCGGGAGGACAAGCTGG No data
1077152182_1077152201 12 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152201 11:1077399-1077421 GGGCGGGGGGGCCTGGGTGGTGG No data
1077152182_1077152191 -5 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152191 11:1077382-1077404 CCCGGGAGGACAAGCTGGGGCGG No data
1077152182_1077152197 0 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152197 11:1077387-1077409 GAGGACAAGCTGGGGCGGGGGGG No data
1077152182_1077152189 -8 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152189 11:1077379-1077401 GGTCCCGGGAGGACAAGCTGGGG No data
1077152182_1077152199 6 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152199 11:1077393-1077415 AAGCTGGGGCGGGGGGGCCTGGG No data
1077152182_1077152200 9 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152200 11:1077396-1077418 CTGGGGCGGGGGGGCCTGGGTGG No data
1077152182_1077152198 5 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152198 11:1077392-1077414 CAAGCTGGGGCGGGGGGGCCTGG No data
1077152182_1077152196 -1 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152196 11:1077386-1077408 GGAGGACAAGCTGGGGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077152182 Original CRISPR CCGGGACCCCGCCGCCCAGA GGG (reversed) Intergenic
No off target data available for this crispr