ID: 1077152190

View in Genome Browser
Species Human (GRCh38)
Location 11:1077382-1077404
Sequence CCGCCCCAGCTTGTCCTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077152190_1077152200 -9 Left 1077152190 11:1077382-1077404 CCCGGGAGGACAAGCTGGGGCGG No data
Right 1077152200 11:1077396-1077418 CTGGGGCGGGGGGGCCTGGGTGG No data
1077152190_1077152201 -6 Left 1077152190 11:1077382-1077404 CCCGGGAGGACAAGCTGGGGCGG No data
Right 1077152201 11:1077399-1077421 GGGCGGGGGGGCCTGGGTGGTGG No data
1077152190_1077152206 28 Left 1077152190 11:1077382-1077404 CCCGGGAGGACAAGCTGGGGCGG No data
Right 1077152206 11:1077433-1077455 ACCCCGATGTGCCTCCGCCAGGG 0: 1
1: 0
2: 0
3: 2
4: 63
1077152190_1077152205 27 Left 1077152190 11:1077382-1077404 CCCGGGAGGACAAGCTGGGGCGG No data
Right 1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077152190 Original CRISPR CCGCCCCAGCTTGTCCTCCC GGG (reversed) Intergenic