ID: 1077152201

View in Genome Browser
Species Human (GRCh38)
Location 11:1077399-1077421
Sequence GGGCGGGGGGGCCTGGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077152190_1077152201 -6 Left 1077152190 11:1077382-1077404 CCCGGGAGGACAAGCTGGGGCGG No data
Right 1077152201 11:1077399-1077421 GGGCGGGGGGGCCTGGGTGGTGG No data
1077152192_1077152201 -7 Left 1077152192 11:1077383-1077405 CCGGGAGGACAAGCTGGGGCGGG No data
Right 1077152201 11:1077399-1077421 GGGCGGGGGGGCCTGGGTGGTGG No data
1077152175_1077152201 25 Left 1077152175 11:1077351-1077373 CCCAGCTTCAGTCCCCTCTGGGC No data
Right 1077152201 11:1077399-1077421 GGGCGGGGGGGCCTGGGTGGTGG No data
1077152176_1077152201 24 Left 1077152176 11:1077352-1077374 CCAGCTTCAGTCCCCTCTGGGCG No data
Right 1077152201 11:1077399-1077421 GGGCGGGGGGGCCTGGGTGGTGG No data
1077152184_1077152201 11 Left 1077152184 11:1077365-1077387 CCTCTGGGCGGCGGGGTCCCGGG No data
Right 1077152201 11:1077399-1077421 GGGCGGGGGGGCCTGGGTGGTGG No data
1077152181_1077152201 13 Left 1077152181 11:1077363-1077385 CCCCTCTGGGCGGCGGGGTCCCG No data
Right 1077152201 11:1077399-1077421 GGGCGGGGGGGCCTGGGTGGTGG No data
1077152182_1077152201 12 Left 1077152182 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG No data
Right 1077152201 11:1077399-1077421 GGGCGGGGGGGCCTGGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077152201 Original CRISPR GGGCGGGGGGGCCTGGGTGG TGG Intergenic
No off target data available for this crispr