ID: 1077152205

View in Genome Browser
Species Human (GRCh38)
Location 11:1077432-1077454
Sequence GACCCCGATGTGCCTCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077152202_1077152205 -1 Left 1077152202 11:1077410-1077432 CCTGGGTGGTGGACCCAAGAGTG No data
Right 1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 53
1077152190_1077152205 27 Left 1077152190 11:1077382-1077404 CCCGGGAGGACAAGCTGGGGCGG No data
Right 1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 53
1077152192_1077152205 26 Left 1077152192 11:1077383-1077405 CCGGGAGGACAAGCTGGGGCGGG No data
Right 1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077152205 Original CRISPR GACCCCGATGTGCCTCCGCC AGG Intergenic
904601318 1:31674156-31674178 GACCCCGATGGGCCTTGGTCAGG - Intronic
920085050 1:203409222-203409244 AACCCAGCTGTGCCTCTGCCTGG - Intergenic
920516990 1:206592491-206592513 CACCCACATGTGCTTCCGCCTGG - Intronic
1067052346 10:43029146-43029168 GACCCAGCAGGGCCTCCGCCCGG + Intergenic
1071288662 10:84172493-84172515 CACCCTGATGAGCCTCTGCCTGG - Intergenic
1076353950 10:129838999-129839021 GCCCCCGAAGTGCCGCCGACTGG - Intronic
1076807782 10:132867795-132867817 GGCCCCGCTGTGCCTCCCGCGGG + Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1096240436 12:49956937-49956959 GACTCAGATCTGCCTCTGCCTGG - Exonic
1105514640 13:21078203-21078225 GACCCCGGGGAGCCTCCGCCAGG + Intergenic
1113718027 13:112528030-112528052 GACCCCTGTGTGGCTCCCCCAGG + Intronic
1113885544 13:113656810-113656832 GACTCCCATGTGCCGCCTCCTGG - Intronic
1126109034 15:45165072-45165094 GACCAGGATGTGTCTCAGCCTGG + Exonic
1129739880 15:77985080-77985102 GCCACCCATGTGCCCCCGCCAGG + Intronic
1130189896 15:81724100-81724122 GACCCCAATGTGCCCAAGCCAGG + Intergenic
1141953230 16:87352875-87352897 AACCCAGATGTGCCGGCGCCTGG - Intronic
1152633517 17:81421156-81421178 GGCCCCCAGCTGCCTCCGCCTGG + Intronic
1159001438 18:62978757-62978779 GCCTCCGATGAGCCCCCGCCCGG + Exonic
1161011301 19:1960513-1960535 GTCCCCCGTGTGCCTGCGCCTGG + Intronic
1162219120 19:9161108-9161130 AACGCTCATGTGCCTCCGCCGGG - Exonic
1164892600 19:31837626-31837648 GACCTCCATGTGCCTTCCCCAGG + Intergenic
1165325956 19:35114958-35114980 TACCCCGAGGTCCCCCCGCCCGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
926315166 2:11704391-11704413 TACCCCGCTCTGCCTCCCCCGGG - Intronic
929033748 2:37671974-37671996 GACCCGGAGGTGCTGCCGCCCGG + Exonic
935333855 2:101997256-101997278 CACCCCGCTGTGCCTCTCCCTGG + Intronic
935947608 2:108300481-108300503 GACCCCCATGTGCCTGCAGCAGG - Intronic
1169939326 20:10919847-10919869 GACCCTCATGGACCTCCGCCAGG - Intergenic
1170791887 20:19515570-19515592 TACCCCTCTGTGCCTCTGCCTGG + Intronic
1176260715 20:64178057-64178079 GATCCTGAGGTGCCTCCTCCGGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1181773057 22:25140633-25140655 GACCCCGAGGTGCCCCTCCCAGG - Intronic
1183160607 22:36110554-36110576 GACCCCAATCTGCCTCCCGCTGG - Intergenic
951625950 3:24663252-24663274 GAGCCCCATGGGCCTCCCCCAGG - Intergenic
956870536 3:73412913-73412935 GACCCCCATGTGTCTCACCCTGG - Intronic
968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG + Intronic
968755886 4:2416602-2416624 TGCCCCCATGTGCCTCTGCCGGG - Intronic
969583187 4:8077261-8077283 GACCCCGCTGTGCCTCCTATGGG + Intronic
991683446 5:69160820-69160842 TACCCCACCGTGCCTCCGCCTGG + Intergenic
992401076 5:76411961-76411983 GCCCCCCATGTGCCACCCCCAGG - Intronic
1000071883 5:157748063-157748085 GACACTGATGTGCCTTTGCCGGG + Intronic
1002293115 5:178213018-178213040 GCCCCCAATGTGCTTCAGCCTGG - Exonic
1002789185 6:425132-425154 CTCCCTGGTGTGCCTCCGCCAGG + Intergenic
1005999742 6:30955690-30955712 GCCCCCGCTGCGACTCCGCCGGG - Intergenic
1006814554 6:36841008-36841030 GAAGCCGATGTGCCTCGGGCCGG + Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1018860425 6:167707171-167707193 AGCCCCGATGTGTCTCCTCCAGG + Intergenic
1019522271 7:1466330-1466352 GACCCCAGTAGGCCTCCGCCAGG - Intergenic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1032566792 7:132954832-132954854 GACCACAATGAGCCTCCGTCAGG - Intronic
1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG + Exonic
1040586693 8:48750121-48750143 GACTCAGATCTGCCTCTGCCTGG - Intergenic
1061204019 9:129152698-129152720 GACCCCGGTGTCCCTACGGCAGG - Intergenic
1062346694 9:136118400-136118422 GACCCGGAAGTGGCTCCGGCAGG - Intronic
1062368524 9:136224112-136224134 GACCCTGGTGTGCTTCCGGCAGG - Exonic
1190121598 X:47664473-47664495 GACTCTGATGTGCCTCAGCATGG + Intergenic
1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG + Intronic