ID: 1077155299

View in Genome Browser
Species Human (GRCh38)
Location 11:1088416-1088438
Sequence AGGAGCGGCGGTGCGGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077155299 Original CRISPR AGGAGCGGCGGTGCGGGTTC AGG (reversed) Intergenic
900124863 1:1064806-1064828 AGGTGCGGGGGTGCGGGGCCCGG + Intergenic
900349593 1:2228302-2228324 AGGAGCGGGGGCGCGGGCGCGGG - Intergenic
900674588 1:3876940-3876962 AGGAGCGTCCGTGTGGGCTCTGG + Intronic
901130917 1:6962354-6962376 AGGAGGGGCGGGGCGGGGTGGGG - Intronic
902465235 1:16613386-16613408 AGGCGCGGCGGCGCGGCTGCCGG - Exonic
903155568 1:21440277-21440299 AGGCGCGGCGGCGCGGCTGCGGG + Intronic
905369281 1:37474633-37474655 AGGCGCGGCGGGGAGGGTGCGGG + Intronic
907905757 1:58782905-58782927 TGGCGCGGAGGTGCGGCTTCAGG + Exonic
908786134 1:67736399-67736421 AGGTGCTGTGGTGTGGGTTCTGG - Intronic
914916481 1:151822366-151822388 AGGAGCTGCGGTGAGGGCCCTGG - Intronic
915330343 1:155107809-155107831 AGGAGCTGCAGTGTGGGTTTTGG + Intergenic
918208282 1:182328715-182328737 AGCTGCGGCTGTGTGGGTTCAGG + Intergenic
920017712 1:202927096-202927118 CGGTGCGGCTGTGTGGGTTCGGG - Exonic
924382144 1:243474805-243474827 AGGAGCGGCTGTGCACGTTCAGG - Intronic
1072108053 10:92292003-92292025 GGGACGGGGGGTGCGGGTTCAGG - Intronic
1075645492 10:124093408-124093430 AGGAGCGGCGGTAGGAGGTCTGG - Intronic
1076406263 10:130214233-130214255 AGGAGGGTCTGTGCGGGGTCTGG + Intergenic
1076908006 10:133372954-133372976 AGGTGGGGGGGTGCGGGGTCAGG + Intronic
1076908034 10:133373021-133373043 AGGTGGGGGGGTGCGGGGTCAGG + Intronic
1076908044 10:133373041-133373063 AGGCGGGGGGGTGCGGGGTCAGG + Intronic
1077155299 11:1088416-1088438 AGGAGCGGCGGTGCGGGTTCAGG - Intergenic
1077311407 11:1890502-1890524 AGCAGGGGCGGTGGGGGTCCAGG + Exonic
1077434674 11:2533052-2533074 AGGAGGGGCCGGGCGGGTGCAGG + Intronic
1078317433 11:10305010-10305032 GGGAGCGGCGGGGCGGGGCCTGG - Intronic
1087962264 11:104366533-104366555 CGGAGCGCCAGCGCGGGTTCCGG - Intergenic
1091238500 11:134037156-134037178 AGGAGGGGCGGTGCAGGGGCGGG + Intergenic
1091697292 12:2636451-2636473 AGGAGCTGCTGGACGGGTTCAGG - Intronic
1094040986 12:26122155-26122177 GGGTGCGGCCGTGCGGGTGCTGG + Exonic
1096199031 12:49668179-49668201 AGGATTGGCTGTGCAGGTTCAGG - Intronic
1096981069 12:55728551-55728573 AGAGGCGGCGGGGCGGGGTCCGG - Intronic
1097187859 12:57205161-57205183 AGGAGAGGCAGCGCTGGTTCCGG - Exonic
1105851583 13:24340406-24340428 AGGTGCGGCGGTGCAGGAGCAGG + Intergenic
1106580904 13:31017381-31017403 AGGAGAGGCGGTGGGGGTCCAGG + Intergenic
1108063259 13:46553360-46553382 AGGAGCGGCGGGGCGGGGTGGGG + Exonic
1113428295 13:110228218-110228240 AGGAGTGGTGGTGCGGGGGCGGG + Intronic
1117284821 14:54277184-54277206 AGGAGGAGCTGTGGGGGTTCAGG - Intergenic
1119616229 14:76100750-76100772 AGGAGAGGGGGTGCGGGTTGGGG + Intergenic
1122159734 14:99774306-99774328 AGGAGCGTGGATGCGGGTTAGGG - Intronic
1122602882 14:102930100-102930122 AGGCGCGGCGGGGCGGGATGGGG - Intronic
1122794650 14:104200117-104200139 AGGAGCTGCGGTGGGGGTGAGGG + Intergenic
1122919647 14:104874738-104874760 AGGACCGGGGGTGGGGGTTGGGG - Intronic
1123056060 14:105571413-105571435 GGGAGCGGCCGAGCGGGTGCTGG + Intergenic
1123057322 14:105577530-105577552 GGGAGCGGCGGAGCGGGTGCTGG - Intergenic
1123057866 14:105580383-105580405 GGGAGCGGCTGAGCGGGTGCTGG - Intergenic
1123080492 14:105691544-105691566 GGGAGCGGCGGAGCGGGTGCTGG + Intergenic
1129251651 15:74312528-74312550 AGGAGGGGTGGTGCGGGGGCAGG - Intronic
1129644750 15:77419878-77419900 GGGCGGGGCGGCGCGGGTTCTGG - Intronic
1131007267 15:88988104-88988126 AGGGGCGGGGGTGCTGGGTCTGG - Intergenic
1131144136 15:90000809-90000831 AGGAGAGCCGGTGCGGGTGTTGG - Intergenic
1132875709 16:2135955-2135977 AGGGGGGGCGGGGCGGGTGCAGG + Intergenic
1133237047 16:4392257-4392279 AGGGGCGGCAGTGGGGGTCCTGG + Intronic
1134519277 16:14911398-14911420 AGGGGGGGCGGGGCGGGTGCAGG - Intronic
1134706947 16:16310053-16310075 AGGGGGGGCGGGGCGGGTGCAGG - Intergenic
1134960593 16:18402071-18402093 AGGGGGGGCGGGGCGGGTGCAGG + Intergenic
1135517718 16:23149337-23149359 AGGCGCGGCGCTGCGGGATGCGG - Intergenic
1139435396 16:66933986-66934008 AGTAGAGCAGGTGCGGGTTCAGG - Exonic
1142345781 16:89553139-89553161 AGGAGCAGCGGCGCGGGCCCTGG + Intronic
1142427669 16:90009304-90009326 AGGAGCCCCGGTGCTGGTACTGG + Exonic
1144601418 17:16617936-16617958 AGTAGCCGCGGTGCGGGTGCGGG + Intergenic
1146009197 17:29180241-29180263 TGGGGCGGCGGGGCGGGCTCCGG - Intronic
1146796436 17:35784599-35784621 AGGAGCAGGGGTGTGGGGTCAGG + Intronic
1148187898 17:45657756-45657778 AGCAGCTGAGGTGGGGGTTCAGG + Intergenic
1149833679 17:59893365-59893387 CGGGGCGGCGGCGCGGGCTCAGG + Intronic
1152946141 17:83198648-83198670 AGAAGCGGGGGTGGGGGTGCAGG - Intergenic
1153285193 18:3450088-3450110 AGGAGCGGCGGGGCGGGAGGGGG + Intronic
1158156628 18:54432980-54433002 AGGAGCAGCAGTGCTGGTACTGG - Intergenic
1160204663 18:76822753-76822775 GGGAGCGGCGGGGCGGGGGCGGG + Intronic
1160714616 19:570642-570664 AGGGGCGGAGGGGCGGGTTGGGG + Intergenic
1160897011 19:1407836-1407858 GGGAGCGGCGGGCCGGGCTCGGG - Intronic
1161040786 19:2109822-2109844 AGGGGAGGCGGAGGGGGTTCGGG + Intronic
1162025014 19:7888743-7888765 AGGAGCTGGGGTGGGGGTGCCGG + Intronic
1162398179 19:10430131-10430153 AGGAACTGTGGTGGGGGTTCTGG + Intronic
1162550708 19:11356913-11356935 AGGAGCGGCTGTGAGTCTTCAGG + Exonic
1162927108 19:13936203-13936225 AGGAGCTGGGGTGGGGGTTGGGG - Intronic
1163311671 19:16518741-16518763 AGGAGCTGGGGTGCCGGCTCTGG + Exonic
1163513090 19:17747735-17747757 GGGAGGGGCGGGGCGGGCTCCGG + Exonic
1166126707 19:40718996-40719018 AGGACCGGCCGGGCAGGTTCAGG + Intronic
925210181 2:2038810-2038832 GGGAGCTGGGGTGTGGGTTCAGG - Intronic
932252618 2:70258008-70258030 AGGACCGGCGGGGCGAGGTCGGG + Intronic
934559805 2:95307178-95307200 TGGAGTGGTGGTGGGGGTTCCGG - Intronic
934729037 2:96644807-96644829 AAGAGGGGCGGTGGGAGTTCAGG + Intergenic
935666348 2:105516243-105516265 AGGAGGGACAGTGCTGGTTCAGG + Intergenic
942338769 2:174920775-174920797 AGGAGCGGGGGTATGGTTTCAGG + Intronic
949048981 2:241887067-241887089 AAGAGCGGTGGTGCAGGTGCGGG - Intergenic
1170159398 20:13296638-13296660 AGGAGGGGCTGTGCTGGTTTAGG + Intronic
1173488332 20:43457957-43457979 AGTAACCGCGGTGCGGGTGCGGG - Exonic
1181534298 22:23533762-23533784 AGGAGCAGGGCTGCGGGTCCAGG + Intergenic
1183705365 22:39472268-39472290 AGGAGAGGCAGTGTGGGTTCAGG + Intronic
1184170853 22:42759006-42759028 AGGAGGGGTGGGGAGGGTTCAGG - Intergenic
954408739 3:50359789-50359811 GAAAGCGGCGGTGAGGGTTCGGG + Intronic
959513656 3:107241450-107241472 AGGAGCAGAGGTGCAGGTGCAGG - Intergenic
964767395 3:160192092-160192114 AGTAGCTGGGGTGCAGGTTCTGG + Intergenic
966743392 3:183254068-183254090 AGGCGCGGCGGGGCGGGGGCGGG - Intronic
968046163 3:195624866-195624888 AGGAGCCGCTGTGCGCGTTCAGG + Intergenic
968308491 3:197665221-197665243 AGGAGCCGCTGTGCGCGTTCAGG - Intergenic
968674561 4:1870854-1870876 CGGAGCGGCAGTGCGGGGACGGG - Intergenic
970441171 4:16082607-16082629 ATGAGCGGCGGGGCGGGCGCGGG + Intronic
973916281 4:55637315-55637337 GGGAGGGGCGGTGCGGGGGCAGG - Intergenic
981713602 4:147732208-147732230 AGGTGCGGCGCCGCGCGTTCAGG - Exonic
984095452 4:175427939-175427961 GGGAGTGCCGGTGCGGGTTCCGG + Intergenic
984964488 4:185128428-185128450 AGGAGCGGGGGTGGGAGTGCGGG - Intergenic
985512477 5:320614-320636 AGGAGGCGCGGGGCGGGTTGGGG + Intronic
985747148 5:1654009-1654031 AGGAGCCGCTGTGCGCGTTCAGG - Intergenic
990581796 5:57173445-57173467 AGGAGCTGCGGCGCAGCTTCGGG + Intergenic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1001401639 5:171449825-171449847 AGGAGTGGGGGTGCAGGTTGGGG + Intronic
1001567228 5:172707441-172707463 TGGAGCGGATGTGCGGATTCTGG - Intergenic
1006904538 6:37524273-37524295 TGGAGGGGGGGTGCGGGTCCAGG - Intergenic
1007558273 6:42783788-42783810 AGGAGTGGGGGTGCGGGGTCAGG - Intronic
1017532891 6:155314463-155314485 CGGAGCGGCGGTGAAGGTCCTGG - Exonic
1017674612 6:156799980-156800002 AGGGGTGGGGGTGAGGGTTCCGG - Intronic
1018966937 6:168496942-168496964 AGGAGAGGCGGTGGGGGCTCCGG - Intronic
1019919329 7:4153041-4153063 AGCAGTGGCTGTGCGGGCTCAGG + Intronic
1022902074 7:34820983-34821005 ATGATGGGCAGTGCGGGTTCAGG - Intronic
1027232982 7:76282750-76282772 AGGAGCGGGGGTGCGGGCCGGGG - Exonic
1029524136 7:101085027-101085049 AGGAGAGGCTGTGGGGGATCAGG - Intergenic
1029539136 7:101172775-101172797 AGGAGCGACCGTGAGGGCTCCGG + Intronic
1033279413 7:139995178-139995200 AGGAGGGGCGGGGAGGGGTCTGG + Intronic
1034147407 7:148884740-148884762 GGGAGGGGCGGGGCGGGTGCTGG + Intergenic
1036708078 8:11059736-11059758 GGGAGCCGCGGGGCGGGGTCCGG - Intronic
1037887909 8:22604781-22604803 AGCAGCGGCTGTGGTGGTTCCGG + Exonic
1041489015 8:58411249-58411271 GGAAGCGGGGGCGCGGGTTCGGG + Exonic
1049551466 8:143261849-143261871 AGGTGCAGGGGTGCGGGTGCGGG - Intronic
1049551500 8:143261973-143261995 AGGTGCAGGGGTGCGGGTGCGGG - Intronic
1049614244 8:143569246-143569268 AGGAGGGGCGGGGCGGGGCCTGG + Intronic
1049796667 8:144500202-144500224 AGGTGCGGCGGTGCGGCTGTGGG + Intronic
1050091159 9:2017028-2017050 GGGCGCGGCAGTGCGGGCTCCGG + Intronic
1052851062 9:33378626-33378648 AGGAGCCAAGGTGGGGGTTCTGG - Intergenic
1060058014 9:120432591-120432613 AGGAGCTGTGGTGAGGTTTCTGG + Intronic
1060727683 9:126016901-126016923 AGGAGAGCAGGTGCGGCTTCGGG + Intergenic
1060742466 9:126108586-126108608 AGGGGCGGCGGGGCGGGGTGGGG - Intergenic
1060770113 9:126326616-126326638 CGGGGCGGCGGCGCGGGCTCGGG + Intergenic
1061163388 9:128909069-128909091 AGGTGAGGCGGTGCAGGTGCTGG - Exonic
1061246135 9:129402074-129402096 AGGAGCAGGGCTGCAGGTTCAGG - Intergenic
1062424137 9:136498236-136498258 GGGGGCGGGGGTGGGGGTTCTGG + Intronic
1062530049 9:136995767-136995789 TGGAGCGGGGGTGGGGGGTCAGG + Intronic
1187565349 X:20444225-20444247 AGGAGCGGCAGTGGAGGTTATGG + Intergenic
1189187919 X:39070141-39070163 GGGAGCGCCGGTGCGGGTTCCGG - Intergenic
1189331392 X:40146775-40146797 GGGAACGGCGGCGGGGGTTCTGG - Intronic
1192394261 X:70762652-70762674 TGGAGCGGCGGTGGGGGATCGGG - Intronic