ID: 1077155975

View in Genome Browser
Species Human (GRCh38)
Location 11:1091017-1091039
Sequence GCATGTGCACCCATGTGGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077155975_1077155977 15 Left 1077155975 11:1091017-1091039 CCGTTCCACATGGGTGCACATGC No data
Right 1077155977 11:1091055-1091077 GCATACCACGTGCATACACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077155975 Original CRISPR GCATGTGCACCCATGTGGAA CGG (reversed) Intergenic