ID: 1077156392

View in Genome Browser
Species Human (GRCh38)
Location 11:1093887-1093909
Sequence AGGGCCACACCTGGGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077156392_1077156406 24 Left 1077156392 11:1093887-1093909 CCATCACACCCAGGTGTGGCCCT No data
Right 1077156406 11:1093934-1093956 AGGTTTTCAGTTGCAAAATGAGG No data
1077156392_1077156400 -3 Left 1077156392 11:1093887-1093909 CCATCACACCCAGGTGTGGCCCT No data
Right 1077156400 11:1093907-1093929 CCTGGGTGGCCCCGTCTCTTTGG No data
1077156392_1077156407 28 Left 1077156392 11:1093887-1093909 CCATCACACCCAGGTGTGGCCCT No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data
1077156392_1077156402 4 Left 1077156392 11:1093887-1093909 CCATCACACCCAGGTGTGGCCCT No data
Right 1077156402 11:1093914-1093936 GGCCCCGTCTCTTTGGGCTCAGG No data
1077156392_1077156401 -2 Left 1077156392 11:1093887-1093909 CCATCACACCCAGGTGTGGCCCT No data
Right 1077156401 11:1093908-1093930 CTGGGTGGCCCCGTCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077156392 Original CRISPR AGGGCCACACCTGGGTGTGA TGG (reversed) Intergenic