ID: 1077156396

View in Genome Browser
Species Human (GRCh38)
Location 11:1093895-1093917
Sequence GGCCACCCAGGGCCACACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077156396_1077156402 -4 Left 1077156396 11:1093895-1093917 CCCAGGTGTGGCCCTGGGTGGCC No data
Right 1077156402 11:1093914-1093936 GGCCCCGTCTCTTTGGGCTCAGG No data
1077156396_1077156407 20 Left 1077156396 11:1093895-1093917 CCCAGGTGTGGCCCTGGGTGGCC No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data
1077156396_1077156406 16 Left 1077156396 11:1093895-1093917 CCCAGGTGTGGCCCTGGGTGGCC No data
Right 1077156406 11:1093934-1093956 AGGTTTTCAGTTGCAAAATGAGG No data
1077156396_1077156408 26 Left 1077156396 11:1093895-1093917 CCCAGGTGTGGCCCTGGGTGGCC No data
Right 1077156408 11:1093944-1093966 TTGCAAAATGAGGATGGAAGTGG No data
1077156396_1077156401 -10 Left 1077156396 11:1093895-1093917 CCCAGGTGTGGCCCTGGGTGGCC No data
Right 1077156401 11:1093908-1093930 CTGGGTGGCCCCGTCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077156396 Original CRISPR GGCCACCCAGGGCCACACCT GGG (reversed) Intergenic
No off target data available for this crispr