ID: 1077156397

View in Genome Browser
Species Human (GRCh38)
Location 11:1093896-1093918
Sequence GGGCCACCCAGGGCCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077156397_1077156408 25 Left 1077156397 11:1093896-1093918 CCAGGTGTGGCCCTGGGTGGCCC No data
Right 1077156408 11:1093944-1093966 TTGCAAAATGAGGATGGAAGTGG No data
1077156397_1077156402 -5 Left 1077156397 11:1093896-1093918 CCAGGTGTGGCCCTGGGTGGCCC No data
Right 1077156402 11:1093914-1093936 GGCCCCGTCTCTTTGGGCTCAGG No data
1077156397_1077156406 15 Left 1077156397 11:1093896-1093918 CCAGGTGTGGCCCTGGGTGGCCC No data
Right 1077156406 11:1093934-1093956 AGGTTTTCAGTTGCAAAATGAGG No data
1077156397_1077156407 19 Left 1077156397 11:1093896-1093918 CCAGGTGTGGCCCTGGGTGGCCC No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077156397 Original CRISPR GGGCCACCCAGGGCCACACC TGG (reversed) Intergenic