ID: 1077156398

View in Genome Browser
Species Human (GRCh38)
Location 11:1093906-1093928
Sequence CAAAGAGACGGGGCCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077156398_1077156407 9 Left 1077156398 11:1093906-1093928 CCCTGGGTGGCCCCGTCTCTTTG No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data
1077156398_1077156406 5 Left 1077156398 11:1093906-1093928 CCCTGGGTGGCCCCGTCTCTTTG No data
Right 1077156406 11:1093934-1093956 AGGTTTTCAGTTGCAAAATGAGG No data
1077156398_1077156408 15 Left 1077156398 11:1093906-1093928 CCCTGGGTGGCCCCGTCTCTTTG No data
Right 1077156408 11:1093944-1093966 TTGCAAAATGAGGATGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077156398 Original CRISPR CAAAGAGACGGGGCCACCCA GGG (reversed) Intergenic