ID: 1077156399

View in Genome Browser
Species Human (GRCh38)
Location 11:1093907-1093929
Sequence CCAAAGAGACGGGGCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077156399_1077156408 14 Left 1077156399 11:1093907-1093929 CCTGGGTGGCCCCGTCTCTTTGG No data
Right 1077156408 11:1093944-1093966 TTGCAAAATGAGGATGGAAGTGG No data
1077156399_1077156407 8 Left 1077156399 11:1093907-1093929 CCTGGGTGGCCCCGTCTCTTTGG No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data
1077156399_1077156406 4 Left 1077156399 11:1093907-1093929 CCTGGGTGGCCCCGTCTCTTTGG No data
Right 1077156406 11:1093934-1093956 AGGTTTTCAGTTGCAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077156399 Original CRISPR CCAAAGAGACGGGGCCACCC AGG (reversed) Intergenic