ID: 1077156400

View in Genome Browser
Species Human (GRCh38)
Location 11:1093907-1093929
Sequence CCTGGGTGGCCCCGTCTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077156392_1077156400 -3 Left 1077156392 11:1093887-1093909 CCATCACACCCAGGTGTGGCCCT No data
Right 1077156400 11:1093907-1093929 CCTGGGTGGCCCCGTCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077156400 Original CRISPR CCTGGGTGGCCCCGTCTCTT TGG Intergenic