ID: 1077156401

View in Genome Browser
Species Human (GRCh38)
Location 11:1093908-1093930
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077156392_1077156401 -2 Left 1077156392 11:1093887-1093909 CCATCACACCCAGGTGTGGCCCT No data
Right 1077156401 11:1093908-1093930 CTGGGTGGCCCCGTCTCTTTGGG No data
1077156396_1077156401 -10 Left 1077156396 11:1093895-1093917 CCCAGGTGTGGCCCTGGGTGGCC No data
Right 1077156401 11:1093908-1093930 CTGGGTGGCCCCGTCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077156401 Original CRISPR CTGGGTGGCCCCGTCTCTTT GGG Intergenic