ID: 1077156402

View in Genome Browser
Species Human (GRCh38)
Location 11:1093914-1093936
Sequence GGCCCCGTCTCTTTGGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077156397_1077156402 -5 Left 1077156397 11:1093896-1093918 CCAGGTGTGGCCCTGGGTGGCCC No data
Right 1077156402 11:1093914-1093936 GGCCCCGTCTCTTTGGGCTCAGG No data
1077156392_1077156402 4 Left 1077156392 11:1093887-1093909 CCATCACACCCAGGTGTGGCCCT No data
Right 1077156402 11:1093914-1093936 GGCCCCGTCTCTTTGGGCTCAGG No data
1077156396_1077156402 -4 Left 1077156396 11:1093895-1093917 CCCAGGTGTGGCCCTGGGTGGCC No data
Right 1077156402 11:1093914-1093936 GGCCCCGTCTCTTTGGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077156402 Original CRISPR GGCCCCGTCTCTTTGGGCTC AGG Intergenic