ID: 1077156404

View in Genome Browser
Species Human (GRCh38)
Location 11:1093917-1093939
Sequence AAACCTGAGCCCAAAGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077156404_1077156406 -6 Left 1077156404 11:1093917-1093939 CCCGTCTCTTTGGGCTCAGGTTT No data
Right 1077156406 11:1093934-1093956 AGGTTTTCAGTTGCAAAATGAGG No data
1077156404_1077156407 -2 Left 1077156404 11:1093917-1093939 CCCGTCTCTTTGGGCTCAGGTTT No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data
1077156404_1077156409 26 Left 1077156404 11:1093917-1093939 CCCGTCTCTTTGGGCTCAGGTTT No data
Right 1077156409 11:1093966-1093988 GTGTCCAGCCCTGAGCTCTCTGG No data
1077156404_1077156408 4 Left 1077156404 11:1093917-1093939 CCCGTCTCTTTGGGCTCAGGTTT No data
Right 1077156408 11:1093944-1093966 TTGCAAAATGAGGATGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077156404 Original CRISPR AAACCTGAGCCCAAAGAGAC GGG (reversed) Intergenic