ID: 1077156407

View in Genome Browser
Species Human (GRCh38)
Location 11:1093938-1093960
Sequence TTTCAGTTGCAAAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077156405_1077156407 -3 Left 1077156405 11:1093918-1093940 CCGTCTCTTTGGGCTCAGGTTTT No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data
1077156399_1077156407 8 Left 1077156399 11:1093907-1093929 CCTGGGTGGCCCCGTCTCTTTGG No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data
1077156404_1077156407 -2 Left 1077156404 11:1093917-1093939 CCCGTCTCTTTGGGCTCAGGTTT No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data
1077156396_1077156407 20 Left 1077156396 11:1093895-1093917 CCCAGGTGTGGCCCTGGGTGGCC No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data
1077156392_1077156407 28 Left 1077156392 11:1093887-1093909 CCATCACACCCAGGTGTGGCCCT No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data
1077156403_1077156407 -1 Left 1077156403 11:1093916-1093938 CCCCGTCTCTTTGGGCTCAGGTT No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data
1077156397_1077156407 19 Left 1077156397 11:1093896-1093918 CCAGGTGTGGCCCTGGGTGGCCC No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data
1077156398_1077156407 9 Left 1077156398 11:1093906-1093928 CCCTGGGTGGCCCCGTCTCTTTG No data
Right 1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077156407 Original CRISPR TTTCAGTTGCAAAATGAGGA TGG Intergenic