ID: 1077156408

View in Genome Browser
Species Human (GRCh38)
Location 11:1093944-1093966
Sequence TTGCAAAATGAGGATGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077156403_1077156408 5 Left 1077156403 11:1093916-1093938 CCCCGTCTCTTTGGGCTCAGGTT No data
Right 1077156408 11:1093944-1093966 TTGCAAAATGAGGATGGAAGTGG No data
1077156405_1077156408 3 Left 1077156405 11:1093918-1093940 CCGTCTCTTTGGGCTCAGGTTTT No data
Right 1077156408 11:1093944-1093966 TTGCAAAATGAGGATGGAAGTGG No data
1077156398_1077156408 15 Left 1077156398 11:1093906-1093928 CCCTGGGTGGCCCCGTCTCTTTG No data
Right 1077156408 11:1093944-1093966 TTGCAAAATGAGGATGGAAGTGG No data
1077156404_1077156408 4 Left 1077156404 11:1093917-1093939 CCCGTCTCTTTGGGCTCAGGTTT No data
Right 1077156408 11:1093944-1093966 TTGCAAAATGAGGATGGAAGTGG No data
1077156397_1077156408 25 Left 1077156397 11:1093896-1093918 CCAGGTGTGGCCCTGGGTGGCCC No data
Right 1077156408 11:1093944-1093966 TTGCAAAATGAGGATGGAAGTGG No data
1077156399_1077156408 14 Left 1077156399 11:1093907-1093929 CCTGGGTGGCCCCGTCTCTTTGG No data
Right 1077156408 11:1093944-1093966 TTGCAAAATGAGGATGGAAGTGG No data
1077156396_1077156408 26 Left 1077156396 11:1093895-1093917 CCCAGGTGTGGCCCTGGGTGGCC No data
Right 1077156408 11:1093944-1093966 TTGCAAAATGAGGATGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077156408 Original CRISPR TTGCAAAATGAGGATGGAAG TGG Intergenic