ID: 1077156409

View in Genome Browser
Species Human (GRCh38)
Location 11:1093966-1093988
Sequence GTGTCCAGCCCTGAGCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077156404_1077156409 26 Left 1077156404 11:1093917-1093939 CCCGTCTCTTTGGGCTCAGGTTT No data
Right 1077156409 11:1093966-1093988 GTGTCCAGCCCTGAGCTCTCTGG No data
1077156405_1077156409 25 Left 1077156405 11:1093918-1093940 CCGTCTCTTTGGGCTCAGGTTTT No data
Right 1077156409 11:1093966-1093988 GTGTCCAGCCCTGAGCTCTCTGG No data
1077156403_1077156409 27 Left 1077156403 11:1093916-1093938 CCCCGTCTCTTTGGGCTCAGGTT No data
Right 1077156409 11:1093966-1093988 GTGTCCAGCCCTGAGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077156409 Original CRISPR GTGTCCAGCCCTGAGCTCTC TGG Intergenic