ID: 1077158005

View in Genome Browser
Species Human (GRCh38)
Location 11:1099954-1099976
Sequence GCTCGTGGTCGTGGGTGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077158005_1077158016 27 Left 1077158005 11:1099954-1099976 CCACGGCACCCACGACCACGAGC No data
Right 1077158016 11:1100004-1100026 AGCACCACCACGTCCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077158005 Original CRISPR GCTCGTGGTCGTGGGTGCCG TGG (reversed) Intergenic
No off target data available for this crispr