ID: 1077165639

View in Genome Browser
Species Human (GRCh38)
Location 11:1135725-1135747
Sequence ACACTATAAAGATGTCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077165639_1077165641 22 Left 1077165639 11:1135725-1135747 CCAGAAAGACATCTTTATAGTGT No data
Right 1077165641 11:1135770-1135792 GTCAGTCAACACTAAAATTTAGG No data
1077165639_1077165642 30 Left 1077165639 11:1135725-1135747 CCAGAAAGACATCTTTATAGTGT No data
Right 1077165642 11:1135778-1135800 ACACTAAAATTTAGGTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077165639 Original CRISPR ACACTATAAAGATGTCTTTC TGG (reversed) Intergenic
No off target data available for this crispr