ID: 1077165641

View in Genome Browser
Species Human (GRCh38)
Location 11:1135770-1135792
Sequence GTCAGTCAACACTAAAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077165639_1077165641 22 Left 1077165639 11:1135725-1135747 CCAGAAAGACATCTTTATAGTGT No data
Right 1077165641 11:1135770-1135792 GTCAGTCAACACTAAAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077165641 Original CRISPR GTCAGTCAACACTAAAATTT AGG Intergenic
No off target data available for this crispr