ID: 1077169456

View in Genome Browser
Species Human (GRCh38)
Location 11:1159741-1159763
Sequence CACCATGCTGGCTCTATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 4, 2: 3, 3: 13, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077169456 Original CRISPR CACCATGCTGGCTCTATGCA GGG Intronic
901504394 1:9675538-9675560 CACCATGCTGCCTCCAAACACGG + Intronic
902843034 1:19087397-19087419 TACCATGCTGCCTCCATTCAGGG - Intronic
904267474 1:29326000-29326022 CACCATCCTGGCTTTTGGCAGGG + Intronic
906131681 1:43462700-43462722 CACAATGCTAGCTCTTTGGATGG - Intergenic
906819884 1:48918412-48918434 CACCAGGCTGCCTCTTTGGAGGG - Intronic
908037817 1:60074473-60074495 TACCATCCTGGCTCACTGCAAGG - Intergenic
908945600 1:69492685-69492707 TATCATGCTGGCTATGTGCATGG - Intergenic
912707061 1:111922674-111922696 CACCATGCTTCCTATATGCCAGG - Intronic
914195507 1:145446211-145446233 CCCCATGCTGCTTCTATCCAGGG + Intergenic
914396704 1:147276390-147276412 CACAGTGCTGGCTGTGTGCAGGG + Intronic
917675184 1:177312026-177312048 TACAACGCTGGCTCTATCCAGGG - Intergenic
918104280 1:181403033-181403055 CACCATGCTGGCTCTAATAATGG - Intergenic
1063549528 10:7017007-7017029 CCAGATGCTGGGTCTATGCAGGG + Intergenic
1063701193 10:8386932-8386954 CACCATGCCTGGCCTATGCAGGG + Intergenic
1068657262 10:59588500-59588522 TACCCTGCTGACTCTGTGCATGG - Intergenic
1073150998 10:101311348-101311370 TACCAGGATGGCTCTCTGCAAGG + Intergenic
1073740933 10:106406125-106406147 CAGCATGCTGTCTCTCTGCCTGG - Intergenic
1074816834 10:117148648-117148670 TACCATGCAGGCTCTCTGGAAGG + Intergenic
1074892257 10:117745507-117745529 CTCCAGGCTGCCTGTATGCATGG + Intergenic
1076684942 10:132194337-132194359 CAGCATGATGGCTGTGTGCAGGG + Intronic
1076821579 10:132942433-132942455 CACCTTGCTGGCTCTCGGCGCGG + Exonic
1077078639 11:712811-712833 CACCAGCCTGGCTGTATGCAGGG - Intronic
1077169339 11:1159341-1159363 CACCATGCTGGTGCTGTGCGGGG + Intronic
1077169393 11:1159520-1159542 CACCATGCTGGTTCTGTGCGGGG + Intronic
1077169424 11:1159627-1159649 CACCATGCTGGCTCTGTGCAGGG + Intronic
1077169437 11:1159674-1159696 CACCATGCTGGTTCTGTGCGGGG + Intronic
1077169456 11:1159741-1159763 CACCATGCTGGCTCTATGCAGGG + Intronic
1077169469 11:1159788-1159810 CACCATGCTGGCTCTGTGCAGGG + Intronic
1077169481 11:1159835-1159857 CACCATGCTGGTTCTGTGCGGGG + Intronic
1077169500 11:1159901-1159923 CACCATGCTGGCTCTGCGACGGG + Intronic
1077169516 11:1159957-1159979 CACCATGCTGGCTCTGTGCAGGG + Intronic
1077169529 11:1160004-1160026 CACCATGCTGGCTCTGTGCAGGG + Intronic
1077169538 11:1160051-1160073 CACTATGCTGGCTCTGTGCAGGG + Intronic
1079290251 11:19181612-19181634 CACGATCTTGGCACTATGCATGG - Intergenic
1080918854 11:36688554-36688576 CAGCATGCTAGGTGTATGCACGG - Intergenic
1082265389 11:50112197-50112219 CTCCATACTGGCTATAAGCAGGG + Intergenic
1086567904 11:88247853-88247875 TACCATGCTGTCTCCATTCAGGG + Intergenic
1087076768 11:94133125-94133147 CACCATGCTGGCACCCAGCAGGG - Intronic
1087759422 11:102089765-102089787 CACCATCTTGGCTCACTGCAAGG - Intergenic
1088235178 11:107715714-107715736 GACCAGGCAGGCTCTATGCTTGG - Intronic
1088279273 11:108120612-108120634 CACCATGCTGTCTGAATTCATGG - Intergenic
1102234445 12:111285574-111285596 GAACTTGCTGGCTCTAAGCAGGG - Intronic
1102489185 12:113278699-113278721 CAGCATCCTGGCTCCAGGCAGGG + Intronic
1105338112 13:19493869-19493891 CACCATGCTGGGTGAATGTAAGG - Intronic
1105552150 13:21407692-21407714 CACCATTCAGGATATATGCATGG - Intronic
1105866770 13:24467898-24467920 AAGAATGCTGGCTCTATGTATGG - Intronic
1108922909 13:55698323-55698345 CACAATGCATGCTCTATGCCAGG - Intergenic
1109260867 13:60143836-60143858 CAACATGCTGGCTCTGGGGATGG - Intronic
1109390450 13:61684961-61684983 AACCATGGTTGCTCCATGCATGG + Intergenic
1112338955 13:98537070-98537092 CACCATCCTGGCTCTCTCCCTGG - Intronic
1114647317 14:24263008-24263030 CACCTTGCTGGATCCAGGCACGG + Intronic
1115485244 14:33903559-33903581 CACTATGCTGTATCTAGGCATGG - Intergenic
1117273244 14:54166525-54166547 CACTACTCTGGCTCTATGCGCGG - Intergenic
1117309550 14:54508000-54508022 CACCATGCTGGGTCTAGGGTGGG + Intergenic
1119097939 14:71851602-71851624 TTCCATGCTAACTCTATGCAGGG - Intergenic
1119325746 14:73758951-73758973 CACCAAGCCGGCCATATGCAGGG + Intronic
1121681276 14:95794649-95794671 CACCATCCTTTCTCCATGCAAGG - Intergenic
1121906458 14:97750654-97750676 CAACACGCTGGTTCTATGCTAGG - Exonic
1122887388 14:104716172-104716194 CACCGGGCTGGCTCTGAGCAAGG - Intronic
1123166622 14:106331207-106331229 CACCATGCAGACTCTGTGAAGGG - Intergenic
1123169308 14:106356246-106356268 CACCATGCAGACTCTGTGAAGGG - Intergenic
1126994263 15:54421862-54421884 CAGAATGCTTGCTCTATGCCAGG + Intronic
1129467635 15:75732802-75732824 CAGCATGCTGGCTCTCTGCAGGG + Intergenic
1129719577 15:77870787-77870809 CACCATGCTGGTTCTCTGCAGGG - Intergenic
1131413361 15:92229884-92229906 CACCACACTGCCTCTGTGCAGGG + Intergenic
1134062573 16:11207998-11208020 CACCAGGCTGGCTCTGTGGTAGG + Intergenic
1137508747 16:49079756-49079778 CACCATGCAGGCTCAATTAATGG - Intergenic
1137599053 16:49743839-49743861 CACCAGGCTGTCTCCATGCCTGG - Intronic
1137868741 16:51929235-51929257 CAACATGCTGGCTCTGTCAAAGG + Intergenic
1139502323 16:67377264-67377286 CAGCCTGCTGGCTCTAGGAAAGG + Intronic
1141590099 16:85062767-85062789 CACCGGGCTGGCTCTGAGCAGGG + Intronic
1141678622 16:85530990-85531012 CACCAGCCTGGCTCTGTGCTGGG + Intergenic
1142596525 17:1032278-1032300 CACCAAGCTGGCTCTGAGGAAGG - Intronic
1147221848 17:38938851-38938873 CACCATACTGAGTCTATACATGG + Intronic
1147571659 17:41575349-41575371 CACTCTGCTGGCTCTCTCCAGGG - Intergenic
1151184017 17:72350347-72350369 CACCATTCTGGTTAAATGCAAGG - Intergenic
1151341551 17:73474449-73474471 CTCCATCCTGGGTCTGTGCAGGG + Intronic
1152134117 17:78493992-78494014 CACCATGCCGGATCCCTGCAAGG + Intronic
1156389450 18:36636788-36636810 CACCATCCCTGCTCTATCCAAGG - Intronic
1161194769 19:2980308-2980330 CTCCATGCTGGGTATCTGCATGG - Intronic
1161768094 19:6217696-6217718 CACCAGCCTGGCTCCAGGCACGG + Intronic
1164304144 19:23988680-23988702 CACCATGCTCTCTGTAGGCAGGG + Intergenic
1164379255 19:27718195-27718217 CACCTAGGTGTCTCTATGCATGG + Intergenic
1165568439 19:36753667-36753689 CACCATGCTTGCTATATGCCAGG + Intronic
925051111 2:816427-816449 CACCATGCAGGCTCAAGGGAGGG - Intergenic
927761610 2:25761290-25761312 TACTATGCTGGGTCTATGCATGG - Intronic
928137391 2:28698118-28698140 CACCATGCTCAGCCTATGCATGG + Intergenic
928631189 2:33194047-33194069 CACGATCCTGGCTCACTGCAAGG + Intronic
929601990 2:43210348-43210370 CCCCATGCTGATTCTTTGCAGGG + Intergenic
931151820 2:59582870-59582892 CACTATGCTGGCACTCTGCTAGG - Intergenic
933292480 2:80453121-80453143 TCCCATGCTTGCTCTATGCTTGG - Intronic
933840644 2:86283451-86283473 AACTAGGCTGGCTCTTTGCAGGG - Intronic
934554194 2:95278758-95278780 CACCACGCTGGATGTCTGCATGG - Exonic
936243520 2:110807636-110807658 GACCCTGCTGGCTCTGTGCGGGG - Intronic
937560451 2:123218278-123218300 CACCATGCTGTCACTATCAAGGG - Intergenic
937916245 2:127100375-127100397 CACCATCAGGGCTTTATGCAGGG + Intronic
938116996 2:128608892-128608914 CACCCTGCTGGATCTACACACGG - Intergenic
938606639 2:132900278-132900300 CAACAGACTTGCTCTATGCAGGG + Intronic
948685487 2:239667107-239667129 CACCATGCTCACTCTCTCCAGGG + Intergenic
1169046196 20:2536353-2536375 GGCCATGCTGCCTCTTTGCAGGG + Intergenic
1169146850 20:3258365-3258387 AACCATGATGGTTCTATGCTTGG + Intronic
1169858882 20:10131645-10131667 CACCTTGCTGGTTCTCTGCCAGG + Intergenic
1170284327 20:14689584-14689606 CACAATGGTGTGTCTATGCATGG + Intronic
1172168501 20:32913991-32914013 CCCCATGGTGGCTCTATGCCTGG + Intronic
1175493652 20:59396521-59396543 CACCATGCCGGGTCTGTGCAAGG + Intergenic
1176146909 20:63569570-63569592 CGCCAGGCCGGCTCTACGCACGG - Exonic
1177584730 21:23075491-23075513 CACCATAATGGTTCTATCCAAGG - Intergenic
1178517658 21:33262454-33262476 CACCATGCTTACTATATGCTGGG - Intronic
1181615818 22:24053715-24053737 CTGGATGCTGGCTCTGTGCAGGG + Intronic
1182429289 22:30290604-30290626 GTCCATGTTGGCTCCATGCAGGG + Intronic
949340961 3:3030392-3030414 AACAATGCTGGCTCTAAGAAAGG + Intronic
949947216 3:9200071-9200093 CAATATGGTGGCTGTATGCAAGG + Intronic
952184087 3:30949626-30949648 CACTATGCTGGTTCTGAGCATGG + Intergenic
952679876 3:36079160-36079182 GACCATGCTGGCTCTGATCATGG - Intergenic
956226214 3:66961973-66961995 CACCAAGCTGACTCTCTGTAAGG + Intergenic
956727057 3:72164783-72164805 CCCCATGCTGTCTCACTGCAGGG - Intergenic
957535956 3:81503892-81503914 CACCATGCTTCCTATATGTATGG - Intronic
959941430 3:112085924-112085946 CACCATGCTGGCACGAGGCATGG + Intergenic
964719686 3:159758779-159758801 CACAATCCTGGCACTATACAGGG + Intronic
966933573 3:184691350-184691372 CATCATTCTGGCTCTTTCCATGG + Intergenic
968702267 4:2062709-2062731 CAGCCTGCTGGCTCCATGAAGGG - Intronic
970368872 4:15388353-15388375 CACCATTCTGGCTGGATGGACGG - Intronic
971377232 4:26064819-26064841 CAATATGCTGACTCTATGCCAGG - Intergenic
972822914 4:42722980-42723002 CAGCAGCCTGTCTCTATGCAAGG + Intergenic
974687157 4:65245023-65245045 CACCATGCTGTCTCAGGGCAGGG + Intergenic
976344762 4:83987837-83987859 TACAATGCTGGCTATAAGCATGG - Intergenic
983323885 4:166228213-166228235 ACCCATGCTGGCTCTGTGCAAGG - Intergenic
983776084 4:171609365-171609387 AACCATGCTTGCTATTTGCATGG + Intergenic
990353832 5:54945685-54945707 CACCATGCTGGCACTCTAAATGG - Intergenic
992935650 5:81701465-81701487 CAACAGACTTGCTCTATGCAGGG + Intronic
999835169 5:155362446-155362468 CAACAGGCTTGCTCAATGCAGGG + Intergenic
1006785589 6:36664754-36664776 CCCCAGGCTGGCACTATACAGGG - Intergenic
1009639653 6:66316988-66317010 CACCATGCTGGCAAGAAGCATGG - Intergenic
1011141687 6:84164895-84164917 CTCCCTGCTGGCTCCTTGCAGGG + Intronic
1016359210 6:143250042-143250064 CACCATGGGGCCTCTAAGCATGG + Intronic
1016546829 6:145233317-145233339 CTCCATGAAGGCTCTAGGCAAGG + Intergenic
1017663221 6:156694235-156694257 CACCATGCTCCCTCTCTGAAGGG - Intergenic
1019158338 6:170053384-170053406 CCCAATGCTGGCGCTATGTAAGG - Intergenic
1019408998 7:898532-898554 CACCGTGCTGGCCCCAAGCAGGG + Exonic
1022573870 7:31479202-31479224 CACCATGCTGGACCGAAGCAGGG - Intergenic
1022744534 7:33157082-33157104 CTCCATGGGGGCTCTAAGCAGGG + Intronic
1024489004 7:49955681-49955703 CAAAATGCTGGCTCTTTGAAAGG + Intronic
1025157141 7:56617219-56617241 CACAATGATGTCTCTGTGCATGG + Intergenic
1025759484 7:64376746-64376768 CACAATGCTCTCTCTAGGCAGGG - Intergenic
1025759687 7:64378305-64378327 CACAATGCTTTCTCTAGGCAGGG - Intergenic
1029236673 7:99125647-99125669 CACCCTGCTGGCACTTTCCACGG + Intronic
1032983716 7:137314634-137314656 CACCATGCTGGATTTCAGCATGG - Intronic
1033975333 7:147093995-147094017 CTCCATGGTGGCTCTGTGCCTGG + Intronic
1040358641 8:46643741-46643763 CACCATGCCCTCTCTAGGCAGGG - Intergenic
1040378329 8:46848053-46848075 CACCAAGCTGGCTATATACGGGG - Intergenic
1040386506 8:46918136-46918158 CAGCCTGCTGGCTCCTTGCAAGG - Intergenic
1042708551 8:71688627-71688649 CAACATACTGCCTCTAAGCATGG - Intergenic
1042789424 8:72587321-72587343 TACCATGCTGTCACTGTGCAAGG - Intronic
1044265155 8:90173356-90173378 CACCTTGCTGGGTCTTTGTATGG + Intergenic
1055270921 9:74557367-74557389 CCTCATGCTGGCTTTCTGCATGG - Intronic
1056064822 9:82923277-82923299 CACCCTCCTGGTTCTGTGCAGGG + Intergenic
1059430829 9:114249400-114249422 CACCACGCTGGCACTACGCATGG - Intronic
1060220686 9:121762643-121762665 CACCTTGCAGGCTCTGTGCTAGG + Intronic
1185943508 X:4347946-4347968 CAGCGTGCTGGCTCTCTGGAAGG + Intergenic
1186952718 X:14645168-14645190 CTCCATGTTTGCTCTGTGCATGG + Intronic
1191062996 X:56318881-56318903 CACCAGGCTGGCTCTAGGATAGG + Intergenic
1195509837 X:105702311-105702333 CACCATACTGGGTAGATGCAAGG + Intronic
1197977728 X:132183101-132183123 CACCATGCTGGGGCTCTGCAGGG + Intergenic
1199603345 X:149556681-149556703 TACCATGATGACTCTGTGCAGGG - Intergenic
1199647042 X:149922794-149922816 TACCATGATGACTCTGTGCAGGG + Intergenic
1200034598 X:153319366-153319388 CACCCTGCTGGCTCCTTGCTAGG + Intergenic
1200897790 Y:8394321-8394343 CACAATGCTTTCTCTAGGCAGGG + Intergenic
1200903713 Y:8459894-8459916 CACAATGCTGTCTGTAGGCAGGG - Intergenic
1202605045 Y:26632183-26632205 AACAATGCTGACTCTATGTATGG - Intergenic