ID: 1077170173

View in Genome Browser
Species Human (GRCh38)
Location 11:1162574-1162596
Sequence GAGCAGCAGCTACACCAAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 218}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077170163_1077170173 25 Left 1077170163 11:1162526-1162548 CCACAGGGTCCTGCTGCCCTTCA 0: 1
1: 0
2: 0
3: 40
4: 401
Right 1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 218
1077170168_1077170173 9 Left 1077170168 11:1162542-1162564 CCCTTCAGCCAGTCTGGGGTCCT 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 218
1077170170_1077170173 1 Left 1077170170 11:1162550-1162572 CCAGTCTGGGGTCCTCATTCAGC 0: 1
1: 0
2: 1
3: 12
4: 151
Right 1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 218
1077170169_1077170173 8 Left 1077170169 11:1162543-1162565 CCTTCAGCCAGTCTGGGGTCCTC 0: 1
1: 0
2: 0
3: 23
4: 235
Right 1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 218
1077170164_1077170173 16 Left 1077170164 11:1162535-1162557 CCTGCTGCCCTTCAGCCAGTCTG 0: 1
1: 0
2: 1
3: 32
4: 327
Right 1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 218
1077170162_1077170173 28 Left 1077170162 11:1162523-1162545 CCTCCACAGGGTCCTGCTGCCCT 0: 1
1: 0
2: 5
3: 55
4: 404
Right 1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077170173 Original CRISPR GAGCAGCAGCTACACCAAGG TGG Exonic
900695266 1:4005738-4005760 GAGGAGCTGCTCCAACAAGGTGG - Intergenic
901202515 1:7474733-7474755 GAGCAGAGGCTACACCAGGGTGG + Intronic
902792648 1:18779419-18779441 CAGCAGAAGCAAAACCAAGGTGG + Intergenic
903431853 1:23310533-23310555 CAGCAGCCGCTTCAGCAAGGTGG - Exonic
904016891 1:27428586-27428608 GAGAAGAAGCTACACCAAAAGGG + Intronic
904482576 1:30803251-30803273 GAGAAACACCTACACCCAGGAGG + Intergenic
911084694 1:93966584-93966606 GAGCAGCAGACACACAAGGGTGG - Intergenic
913598045 1:120396379-120396401 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914089284 1:144482941-144482963 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
914309327 1:146451274-146451296 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914385102 1:147161192-147161214 AAGCAGCAGAAAAACCAAGGAGG + Intronic
914512349 1:148345282-148345304 GGGCAGCAGCAACTCCAAGGGGG - Intergenic
914592784 1:149121863-149121885 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
916351684 1:163857051-163857073 GAGAAGCAACTACACCTAGGTGG + Intergenic
917660379 1:177171691-177171713 GAGCAGCTGATACAGCAAGGAGG + Exonic
918435674 1:184510451-184510473 GAGCTGCAGCTATTCAAAGGAGG + Intronic
919983041 1:202654200-202654222 AAGCAGCAGCTAAAGCAATGGGG - Intronic
924858282 1:247896212-247896234 GAGCAGGATAAACACCAAGGGGG - Exonic
1062792529 10:318061-318083 AAGCAGCAGCTGCATCACGGTGG + Intronic
1063607147 10:7532833-7532855 GAGCAGCTGCTACTCAAACGTGG - Intergenic
1065034547 10:21624668-21624690 CAGCAGCCGCTTCAGCAAGGTGG - Intronic
1066030457 10:31418020-31418042 AAGCAGCCTCTGCACCAAGGAGG + Intronic
1066367671 10:34792662-34792684 GAGCTGCACCTGCACCCAGGAGG + Intronic
1067192804 10:44085509-44085531 GAGCAACAGCTACAGAAAGGAGG - Intergenic
1069044059 10:63723946-63723968 CAGCTGCAGCTGCTCCAAGGAGG + Intergenic
1069121698 10:64576500-64576522 CAGCTGCAGCTGCACCAGGGAGG - Intergenic
1070009411 10:72457563-72457585 GAGCAACACCAACACCAAGCTGG + Intronic
1070328315 10:75401782-75401804 CAAAAGCAGCTGCACCAAGGGGG + Exonic
1071360739 10:84843760-84843782 CAGCATCCACTACACCAAGGGGG - Intergenic
1073191674 10:101655657-101655679 AAGCTGCAGCTGCAACAAGGCGG + Intronic
1073286853 10:102394687-102394709 GAGCAGCAGCTGCACACAGCCGG + Exonic
1075214683 10:120521807-120521829 GAGCAGCAGCTATGCCAAAATGG + Intronic
1077011883 11:382462-382484 GAGGAGCTGCTGCACCCAGGTGG + Intergenic
1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG + Exonic
1078505330 11:11936394-11936416 GAGAAGAAGATACACCAATGGGG + Exonic
1078721597 11:13889662-13889684 GAGCAGCAGCAATAGCAACGGGG + Intergenic
1080156955 11:29122463-29122485 GAGCATCAGCTTCACAAAAGAGG + Intergenic
1080748054 11:35126764-35126786 AGGCAGCAGCAAGACCAAGGTGG + Intergenic
1081741827 11:45446323-45446345 GAGCTGCATCTGCCCCAAGGAGG - Intergenic
1081856659 11:46308210-46308232 GAGCCTCAGTTACTCCAAGGGGG - Intronic
1083322821 11:61857650-61857672 GAGAGGCAGCTACCCCAGGGAGG - Intronic
1085305661 11:75484337-75484359 CAGCAGCAGCTGCACCAGAGGGG + Intronic
1085346327 11:75770339-75770361 GAGCAGCACCCACACCAAGAGGG - Intronic
1085514874 11:77106179-77106201 GGGCAGCAGCTACTCTGAGGCGG - Intronic
1085751649 11:79167577-79167599 GATCAGCAGCAAGACCCAGGAGG - Intronic
1086058368 11:82674941-82674963 AAGCAGGAGATACACCAGGGAGG - Intergenic
1089564527 11:119363861-119363883 GAGCAGGAGCCCCACGAAGGTGG + Intronic
1089822648 11:121241881-121241903 CAGCTGCAGCTGCACCCAGGAGG + Intergenic
1090198617 11:124838600-124838622 GAGCTGGAGCTGCACCCAGGTGG - Intergenic
1090965100 11:131591383-131591405 CAGCAGCAGATAGACCAAGCAGG - Intronic
1091541389 12:1465799-1465821 TAACAGCAGCAACAGCAAGGAGG - Intronic
1092131140 12:6114154-6114176 GAGAAGGAGAAACACCAAGGAGG - Intronic
1095710826 12:45286130-45286152 GAGCAGCAGCAACAGCACGATGG + Intronic
1096363064 12:51004863-51004885 GAGCAGCAGCCCCACAAGGGTGG + Exonic
1098290957 12:68956351-68956373 CAGCTGCAGCTGCACCCAGGAGG + Intronic
1098963400 12:76762532-76762554 GAGCAGCAGTTACTCAAAGAGGG - Intergenic
1100784671 12:98066278-98066300 GACCAGCAGCTACACCCCTGGGG - Intergenic
1102997705 12:117362432-117362454 GAGCAGCAGCAACAGCAACGGGG - Intronic
1103145357 12:118590639-118590661 GAGAAGCAGCTGCATCAGGGTGG + Intergenic
1104153445 12:126107316-126107338 CAGCAGCAGCTTCACCCAGAAGG - Intergenic
1104490048 12:129186221-129186243 GAGCTGGAGATGCACCAAGGTGG - Intronic
1104607803 12:130202840-130202862 GATCAGCAGCAACACAAAGTGGG - Intergenic
1104608308 12:130205834-130205856 GATCAGCAGCAACACAAAGTGGG + Intergenic
1104953222 12:132451637-132451659 GAGGAGCAGCCACAGGAAGGCGG + Intergenic
1105595496 13:21833968-21833990 GGGCAGAAGCTAAACTAAGGGGG + Intergenic
1106379432 13:29222685-29222707 CAGCTGCAGCTGCACCCAGGAGG - Intronic
1106445936 13:29830947-29830969 CAACAGCAGATACAGCAAGGAGG - Intronic
1107722485 13:43263329-43263351 GAGCAGCACCTTGACCTAGGGGG - Intronic
1108591184 13:51914341-51914363 GAGCAGCACTGTCACCAAGGTGG + Intergenic
1109762331 13:66845621-66845643 CAGCAGCCGCTGCACCTAGGAGG + Intronic
1110461413 13:75749623-75749645 GAGCAACAGCCAAACCAACGAGG - Intronic
1118435864 14:65770451-65770473 CACCATCAGCCACACCAAGGGGG + Intergenic
1119565378 14:75624442-75624464 GAGAAGCAGCTTCAAGAAGGGGG + Intronic
1121082980 14:91123674-91123696 GAGGATCATCTACACCCAGGGGG - Intronic
1123995262 15:25713716-25713738 GATCAACGTCTACACCAAGGGGG - Exonic
1124095474 15:26644801-26644823 GAGCAGAAGCAAGTCCAAGGTGG + Intronic
1124119282 15:26875325-26875347 GCCCTGCAGCTACACCAATGTGG + Intronic
1124820742 15:33043885-33043907 CAGCTGCAGCTGCACCCAGGAGG - Intronic
1126262948 15:46715556-46715578 GAGTACCTGCTACACTAAGGCGG + Intergenic
1126825763 15:52546305-52546327 TTGCAGCAGCCACACCCAGGAGG + Intergenic
1128615699 15:69107315-69107337 CAGAACCAGCTGCACCAAGGGGG + Intergenic
1128781095 15:70359193-70359215 GAGCACCAGCTTTTCCAAGGAGG + Intergenic
1129607095 15:77030314-77030336 GAGCAGCAGCAGCACCAGCGTGG + Intronic
1130958764 15:88645809-88645831 GTGCATCAGCAACAGCAAGGAGG - Intronic
1133481556 16:6175721-6175743 CAGCAGCAGCGGCACCAATGGGG - Intronic
1134578132 16:15349195-15349217 GAGCCGCAGCCACACCGAGCAGG - Intergenic
1134724459 16:16408351-16408373 GAGCCGCAGCCACACCGAGCAGG + Intergenic
1134942971 16:18303508-18303530 GAGCCGCAGCCACACCGAGCAGG - Intergenic
1136019337 16:27430091-27430113 GAGCAGCAGCAGGAGCAAGGGGG - Exonic
1136653917 16:31697694-31697716 CAGCTGCAGCTTCACCAAAGAGG + Intergenic
1137334452 16:47533877-47533899 CAGCTGCAGCTGCACCAGGGAGG + Intronic
1138050226 16:53768719-53768741 AAGCAGCAGCCTCACCAAGCAGG - Intronic
1138077494 16:54057085-54057107 GAGCAGCAGGCATACAAAGGAGG + Intronic
1138597296 16:58035835-58035857 GAGCAGCTGCTGACCCAAGGAGG - Intronic
1141095181 16:81158180-81158202 GAGCACCAGGTGCACCACGGGGG - Intergenic
1141370455 16:83481689-83481711 TAGCAGCAGCTCCTCCAAAGGGG - Intronic
1142154851 16:88528264-88528286 GGGCGGCTGCTCCACCAAGGAGG + Intronic
1142315208 16:89339794-89339816 GAGGAGCAGCCACAGCAGGGTGG - Intronic
1143082870 17:4394516-4394538 TGGAAGGAGCTACACCAAGGTGG - Intergenic
1145063688 17:19748035-19748057 GCGGAGCAGGGACACCAAGGTGG - Intronic
1145971147 17:28957161-28957183 GAGAAGCAGCTACACCCAGCAGG - Exonic
1146374520 17:32285206-32285228 GTGCAAGAGCTACACCAAGAAGG - Intronic
1148236399 17:45972010-45972032 GAGCAGCAGATGCAGCCAGGAGG - Intronic
1148770083 17:50061444-50061466 GGGCAGCAGCAGCAACAAGGGGG + Intronic
1149085348 17:52709879-52709901 CAGCTGCAGCTACACCCAGAAGG - Intergenic
1151380098 17:73719844-73719866 GAGCAGCTGGTACACAAAAGAGG - Intergenic
1151948079 17:77330224-77330246 GAGCAGCAGGTGCTCCAAGAGGG - Intronic
1152011506 17:77721681-77721703 GAGCAGCAGCCAGACCCGGGCGG - Intergenic
1152120427 17:78415010-78415032 CAGCAGCAGCTTCACCAGGTTGG + Exonic
1152408112 17:80108784-80108806 GTGCAGGAGCTGCACCAGGGCGG + Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1155751794 18:29433278-29433300 GGGGAGCAGCAAAACCAAGGAGG + Intergenic
1157200945 18:45659079-45659101 CAGCAGCTCCTACACCAAGCAGG + Intronic
1157643147 18:49238638-49238660 GTGCAACAGCACCACCAAGGGGG + Intronic
1160900734 19:1426839-1426861 GAGAAGCTGCCGCACCAAGGAGG - Intronic
1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG + Exonic
1163669325 19:18618204-18618226 GACCAGCAGCAAGGCCAAGGTGG + Exonic
1166369303 19:42292440-42292462 GAGCAGGGGCTGCACGAAGGCGG - Exonic
1167503528 19:49860160-49860182 GAGCAGGAGCAACAGCAACGAGG + Exonic
927445422 2:23156789-23156811 CCACAGCAGCTACAGCAAGGAGG - Intergenic
927494315 2:23542418-23542440 GAGAACCAGAGACACCAAGGTGG - Intronic
927633008 2:24790677-24790699 GAGTAACAGCTTTACCAAGGAGG + Intronic
934571756 2:95377057-95377079 GAGCAGGAGCCACTCCAAGGTGG - Intronic
934986055 2:98885335-98885357 GAGGAGCTGCTAAACCAAGGGGG + Intronic
935170426 2:100607295-100607317 GAGCAGCTTCCACAGCAAGGAGG + Intergenic
936290272 2:111217462-111217484 CAGCTGCAGCTGCACCCAGGAGG + Intergenic
937231534 2:120400823-120400845 GAGCAGCAGCTGCCTAAAGGGGG - Intergenic
938739659 2:134219158-134219180 GTGCAGCGGCTTCATCAAGGAGG + Intronic
942103908 2:172613966-172613988 CAGCTGCAGCTGCACCCAGGAGG - Intergenic
943820480 2:192315007-192315029 CAGCTGCAGCTACGCCCAGGGGG + Intergenic
944941189 2:204629539-204629561 GTGCAGCAGATACAGAAAGGAGG - Intronic
946535201 2:220620127-220620149 CAACAGCAGCAACACCCAGGAGG + Intergenic
946789478 2:223285548-223285570 TGGCTGCAGCTACACCCAGGAGG + Intergenic
948282643 2:236759840-236759862 TAACAGCAGCTACACCATGATGG - Intergenic
1169225730 20:3855536-3855558 GAACAGCAGCTACAACGGGGAGG - Intronic
1173116055 20:40244151-40244173 GAGCAACAGCTGCAACCAGGTGG - Intergenic
1174580634 20:51569110-51569132 CAGGAGCAGGAACACCAAGGTGG - Intergenic
1179506888 21:41847097-41847119 GAGCTGCAGCTCCAGGAAGGTGG + Exonic
1181141375 22:20807712-20807734 GAGCTTCAGCCACAGCAAGGAGG - Intronic
1181330521 22:22087172-22087194 GAGAAGCATCTACTCCCAGGTGG - Intergenic
1182122586 22:27797375-27797397 GAGCACGAGCTACGCCAATGAGG - Exonic
1183693218 22:39403166-39403188 GACCATCAGCTCCACAAAGGCGG - Intronic
1184696650 22:46143144-46143166 GAACAGCAGCTAGACCAGGCCGG + Intergenic
1184973239 22:48042885-48042907 GAGCAGCTGCCAGGCCAAGGAGG + Intergenic
949102047 3:157346-157368 GAGCTGTAGCTACACAAAGATGG + Intergenic
950078110 3:10201685-10201707 GAGCAGCAGCTCCCCTAGGGAGG - Intronic
952818749 3:37467927-37467949 GCTCAGCCGCTACAGCAAGGGGG + Intronic
953889182 3:46737765-46737787 GAGCTGCTGCTACACCTAGCTGG + Intronic
955024140 3:55151022-55151044 GACCCCCAGCCACACCAAGGAGG + Intergenic
955921150 3:63956697-63956719 AAGCAGCAGCTCCACCAGAGTGG - Intronic
956295339 3:67705802-67705824 TAGCAACAGCAAAACCAAGGAGG - Intergenic
956326198 3:68055611-68055633 AAGCAGAAGCTTCACCTAGGAGG - Intronic
958963808 3:100536352-100536374 CAGCAGTGGCTACACCAAGTGGG - Intronic
962414250 3:135168060-135168082 CAGCAGCAGCTGCACCATGAAGG + Intronic
962904444 3:139789241-139789263 GAGCAGGAGCGAAACCATGGAGG + Intergenic
964650935 3:159010385-159010407 CAGCAGCAGCAACACCAGGTAGG - Intronic
966840031 3:184081071-184081093 CAGCTGCAGCTGCACCCAGGAGG - Intergenic
966971345 3:185048273-185048295 AACCTGCAGCCACACCAAGGAGG + Intronic
968930385 4:3575763-3575785 GTGCAGCGGCTCCTCCAAGGTGG + Intergenic
969531651 4:7733965-7733987 GAACAGCCTCCACACCAAGGAGG + Intronic
970401935 4:15725513-15725535 GAGCAGCAGCGACATGAGGGTGG - Intronic
971656789 4:29357577-29357599 CAGCAAAAGCTACACCAAGAGGG - Intergenic
972106358 4:35493996-35494018 CAGCTGCAGCTGCACCCAGGAGG - Intergenic
972203790 4:36747544-36747566 GGGCTGCAGCTACACCTGGGAGG - Intergenic
972516621 4:39815538-39815560 GAGCAGATGCTGCACCAAGCAGG + Intergenic
972765869 4:42151991-42152013 GTGCGGCAGCTCCACCAGGGTGG + Exonic
976734636 4:88297073-88297095 CAGCAGCGGCTGCAGCAAGGAGG - Intergenic
980450042 4:132958798-132958820 CAGCTGCAGCCCCACCAAGGAGG - Intergenic
983379997 4:166980646-166980668 GACCAGCAGCTGCAGCAGGGTGG + Intronic
984740290 4:183154959-183154981 GAGCAGCTGCGAGAGCAAGGCGG - Intronic
986466924 5:8034997-8035019 GAGCAGCAGCAGCACCAGGGAGG + Intergenic
990328118 5:54698135-54698157 CAGCAGTATCTACAACAAGGTGG - Intergenic
991359396 5:65803573-65803595 TAGCTGTAGCTACACCCAGGAGG + Intronic
992616098 5:78547767-78547789 GAGCGGCAGTTAAACCGAGGAGG - Intronic
994201874 5:96985840-96985862 GAGCAGCAGCCATACCCAGCAGG + Intronic
994691123 5:103020773-103020795 GAAAAGCAGCAACAGCAAGGGGG + Intronic
996618140 5:125466820-125466842 GATCAGAAGCAGCACCAAGGAGG + Intergenic
998228714 5:140345967-140345989 GACCAGCTGCTACCCCTAGGAGG - Exonic
998470795 5:142382375-142382397 GAGCAGTAGCAGCACCAAGTGGG - Intergenic
998486668 5:142508880-142508902 GAGCAGCAGCTAAAGGGAGGGGG + Intergenic
1003212025 6:4077411-4077433 GAGCAACAGCTACAACAAAATGG - Exonic
1004269016 6:14177275-14177297 CTGCAGCAGCCACACCAAGTTGG + Intergenic
1005021572 6:21423711-21423733 CAGCTGCAGCTGCACCCAGGAGG + Intergenic
1005781809 6:29201030-29201052 CAGCTGCAGCTGCACCAGGGAGG - Intergenic
1006500804 6:34457802-34457824 GGGCTGCAGCTGCACCCAGGAGG - Intergenic
1006747257 6:36351952-36351974 GAGTAGCAGCTTCCCCAAAGAGG - Intergenic
1008818738 6:55605139-55605161 GAGCAGCACCTTCCCCAGGGTGG + Intergenic
1011063188 6:83294710-83294732 AAGCTGCAGTTACCCCAAGGAGG + Intronic
1011655691 6:89549827-89549849 AAACATCAGCTACATCAAGGTGG + Intronic
1011673640 6:89709331-89709353 GAACAGCAGGTACATTAAGGAGG + Intronic
1012133062 6:95520008-95520030 GAGCTGCAGCTGCGCCCAGGAGG + Intergenic
1012752679 6:103183802-103183824 CAGCTGCAGCTGCACCCAGGAGG - Intergenic
1013327523 6:109062407-109062429 GGTCAGCAGCCACACCATGGAGG + Intronic
1016110675 6:140219415-140219437 GAGAAGAAACTACTCCAAGGAGG - Intergenic
1018865058 6:167739910-167739932 GGGGAGCAGCCACACCATGGCGG - Intergenic
1019855850 7:3606546-3606568 GACCAGCAGTGACACCAGGGTGG - Intronic
1021561361 7:21971859-21971881 GAGCAGCAGCTGCAGCAGAGAGG - Intergenic
1028136656 7:87230157-87230179 CAGCTGCAGCTGCACCCAGGAGG - Intergenic
1028233198 7:88330100-88330122 AAGCAGTAGCTCCACCCAGGAGG + Intergenic
1031248547 7:119350240-119350262 CAGCTGCAGCCCCACCAAGGAGG - Intergenic
1033465613 7:141586733-141586755 GAGCAGAAGCAGCATCAAGGGGG + Intronic
1034885353 7:154794524-154794546 GAGCATCAGCTGCAACGAGGAGG - Intronic
1036825443 8:11972240-11972262 GAGCAGCATCTCCACCAGGCTGG + Intergenic
1036990259 8:13584394-13584416 GAGGAGCAGCTGCACCAATCTGG - Intergenic
1044559738 8:93601428-93601450 GAGCAGCAGCTGCAGGAACGGGG + Intergenic
1044824741 8:96185184-96185206 AAGCAGCAACTAAAGCAAGGTGG + Intergenic
1044962229 8:97542605-97542627 AAGCTGCAGCTGCACCTAGGAGG - Intergenic
1045469389 8:102497548-102497570 GGGCAGCTGATACACCAAGAGGG + Intergenic
1045540314 8:103077963-103077985 GTGCAGCAGATGCACCTAGGTGG + Intergenic
1048437454 8:134431689-134431711 GAGCATCAGATACATCCAGGTGG - Intergenic
1049214964 8:141403293-141403315 CAGCATCAGCAACACCAGGGAGG - Intronic
1049363299 8:142224573-142224595 GAGCAGTGGCTGCACCAAGTAGG - Intronic
1050728571 9:8680931-8680953 AAGCAGCAGCAACACAATGGAGG + Intronic
1053455048 9:38227219-38227241 CAGCTGCAGCTACAGCCAGGAGG + Intergenic
1054459723 9:65456151-65456173 GTGCAGCGGCTCCTCCAAGGTGG - Intergenic
1055203403 9:73695832-73695854 GAGCAGCAGCAAGAGCAAGAGGG - Intergenic
1055892915 9:81142253-81142275 GAGCAGCAGCCAGATCCAGGAGG - Intergenic
1058091804 9:100813970-100813992 CAGCTGCAGCTCTACCAAGGAGG + Intergenic
1058130482 9:101247193-101247215 GAGCAGCAGCTCCTGGAAGGAGG + Intronic
1058169034 9:101656824-101656846 GAGAAGCAGCTTCACCTATGAGG + Intronic
1059427829 9:114232089-114232111 GAGCAGCTGTTGCAGCAAGGAGG + Intronic
1059763359 9:117360534-117360556 GACCAGCAGCTCCACGAGGGTGG - Intronic
1059919922 9:119148711-119148733 GATCAGCATATACACCAATGAGG - Intergenic
1061034512 9:128106236-128106258 GAGCAGCATCTACCCAATGGAGG + Exonic
1185520722 X:736520-736542 GAGCAGCAGAAACTCCAGGGAGG - Intergenic
1186254854 X:7707412-7707434 AGACAGCATCTACACCAAGGAGG + Intergenic
1187041496 X:15600860-15600882 GAGCAGCAGTTACAGCAACAAGG + Exonic
1187242074 X:17522571-17522593 GAAGAGCAGCCACACCCAGGCGG - Intronic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1199861208 X:151801639-151801661 TAGCTGCAGCTCCACCCAGGAGG + Intergenic
1201470918 Y:14334183-14334205 AGACAGCATCTACACCAAGGAGG + Intergenic