ID: 1077174785

View in Genome Browser
Species Human (GRCh38)
Location 11:1183969-1183991
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 2, 1: 0, 2: 0, 3: 18, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077174785_1077174794 11 Left 1077174785 11:1183969-1183991 CCCACGGAGCCCAGCACATCCTC 0: 2
1: 0
2: 0
3: 18
4: 190
Right 1077174794 11:1184003-1184025 AGCTTTGCACCTGGACCGAGTGG 0: 2
1: 0
2: 0
3: 8
4: 81
1077174785_1077174792 2 Left 1077174785 11:1183969-1183991 CCCACGGAGCCCAGCACATCCTC 0: 2
1: 0
2: 0
3: 18
4: 190
Right 1077174792 11:1183994-1184016 GCCTGCAGGAGCTTTGCACCTGG 0: 2
1: 0
2: 1
3: 15
4: 181
1077174785_1077174795 19 Left 1077174785 11:1183969-1183991 CCCACGGAGCCCAGCACATCCTC 0: 2
1: 0
2: 0
3: 18
4: 190
Right 1077174795 11:1184011-1184033 ACCTGGACCGAGTGGATTGATGG 0: 1
1: 1
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077174785 Original CRISPR GAGGATGTGCTGGGCTCCGT GGG (reversed) Intronic
900146425 1:1160814-1160836 CAGGATGGGCCTGGCTCCGTGGG - Intergenic
900380446 1:2381510-2381532 GAGGGTGTGCGGGCCTCGGTTGG + Intronic
902780737 1:18703193-18703215 GAAGCTGTGGCGGGCTCCGTAGG - Exonic
903619998 1:24691110-24691132 GAGGATGTTCTGGGGCCTGTGGG + Intergenic
905873132 1:41416286-41416308 GCGGTTGAGCTGGGCTCCCTGGG - Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
912209807 1:107545418-107545440 CAGGATGTGCTGGGCCCCACAGG - Intergenic
914048748 1:144114280-144114302 GGGGATGTGCTGACCTCAGTGGG - Intergenic
914130436 1:144851168-144851190 GGGGATGTGCTGACCTCAGTGGG + Intergenic
914248371 1:145902106-145902128 GAGGGTCTGCTGGGCTCAGTTGG + Intronic
915713376 1:157922246-157922268 GAGGTTGCAGTGGGCTCCGTAGG + Intergenic
918429876 1:184448429-184448451 GAGGATTTGCTGGAATCCTTGGG + Intronic
919491782 1:198213326-198213348 GATGCAGTGCTGGGCTCAGTGGG + Intronic
920942545 1:210497675-210497697 GAGGATGTGCTGTTTTCAGTGGG + Intronic
922546648 1:226462989-226463011 GGGGCTGTGCTGGGCATCGTAGG + Intergenic
922703466 1:227775949-227775971 GAGGATGCCCTGGGCGCTGTGGG - Intronic
924442710 1:244099797-244099819 GAGGCTTTGCTGGGCGCCGTGGG - Intergenic
924797326 1:247301560-247301582 GGGGATGGGGTGGTCTCCGTGGG - Intronic
1062917615 10:1253885-1253907 TAGGATGCGGTGGGCTCTGTGGG + Intronic
1063227924 10:4033758-4033780 GACGAAGTCCTGGGCTCTGTTGG + Intergenic
1069717404 10:70529925-70529947 ATGGATGTGCTGGGCACCGTGGG + Exonic
1071050215 10:81439119-81439141 GAGGAAGTGCTGGAGTCTGTTGG - Intergenic
1072306572 10:94113493-94113515 GTGGATGGGCTGGGAGCCGTAGG + Intronic
1073319471 10:102605804-102605826 GAGGTTGGGCTGGGCTCAGCAGG + Intronic
1076031505 10:127163042-127163064 GAGGATGTGCTGTGCTGCCCCGG - Intronic
1077080177 11:721551-721573 GAGGATTTGCTGGGGTCAGAGGG - Exonic
1077174570 11:1182850-1182872 GAGGATGTGCTGGGCTCCGTGGG - Intronic
1077174785 11:1183969-1183991 GAGGATGTGCTGGGCTCCGTGGG - Intronic
1077437769 11:2550974-2550996 GAGGCTGTGCTGAGCTCAGTGGG + Intronic
1079441192 11:20516354-20516376 GAGGATGTGTTGAGCACAGTAGG + Intergenic
1080653564 11:34241380-34241402 GAGGATGAGGTGGGCACCCTTGG - Intronic
1081543060 11:44050124-44050146 AAGGATGTTCTGGGCTGTGTTGG + Intronic
1084567809 11:69941707-69941729 GAGACTGGGCTGGGCTCCCTGGG + Intergenic
1084675374 11:70630940-70630962 GAGGATGCGTTGGGCGCCGGAGG - Intronic
1085607535 11:77915549-77915571 GAGGGTGTCCTGGGCTCCCCTGG - Intronic
1087192934 11:95274844-95274866 GAGGCTGTGTTGAGCTCAGTGGG + Intergenic
1089627901 11:119763027-119763049 AAGGATGTTTTGGGCTCTGTGGG + Intergenic
1091810224 12:3390855-3390877 TAGGAGGTGCTAGGCTCCGGAGG - Intronic
1091957186 12:4655884-4655906 GAGACTGTCCTGTGCTCCGTAGG - Intronic
1092238157 12:6822342-6822364 TAGGGTGTACTGGGCTCCGGAGG + Intronic
1096368475 12:51048368-51048390 CAGGGTGTGCTGGGCTCGGTCGG + Exonic
1096523641 12:52198174-52198196 TAGGCTGTGCTGGGCTCACTGGG + Intergenic
1102101533 12:110281817-110281839 GAGGAGGTGCTGGGCCACTTCGG + Exonic
1102122431 12:110452009-110452031 GGGGATGTGCTGGGCTGCCTGGG - Intergenic
1104067011 12:125314478-125314500 GAGGTGGTGCTGGGCTTCCTGGG + Intronic
1104801514 12:131558127-131558149 GAGGATGTGCCGGGCACTGCAGG + Intergenic
1104898917 12:132177394-132177416 GATGGGTTGCTGGGCTCCGTGGG + Intergenic
1105518883 13:21114009-21114031 GTGGATGTGCTGAGCCACGTGGG + Intergenic
1105818240 13:24056588-24056610 GACACTGTGCTGGGCTCTGTGGG - Intronic
1106242818 13:27924205-27924227 GGGGCTGTGCGGGGCTCCGGGGG + Intronic
1109269210 13:60235633-60235655 GAGGGTTTACTGGGCTCAGTTGG - Intergenic
1112122020 13:96423461-96423483 GAGAGTGTGCTGGGGTCCGGTGG + Intronic
1118619214 14:67599779-67599801 GTGGCTGTGCTCTGCTCCGTGGG - Intronic
1118742689 14:68751855-68751877 GAGGATGTTCAGAGCTCTGTCGG + Intergenic
1120852864 14:89186873-89186895 CATGGTGTGCTGGGCTCCCTTGG + Intronic
1123418686 15:20113884-20113906 GGGGATGTGCTGACCTCAGTGGG - Intergenic
1123527905 15:21120422-21120444 GGGGATGTGCTGACCTCAGTGGG - Intergenic
1124147352 15:27139992-27140014 GAGGATGAGCAGGGCCCCGGAGG + Intronic
1124157076 15:27235337-27235359 GAGGATTTGCTGGGCTGTGGCGG - Intronic
1129735507 15:77959386-77959408 GAGGAGGAGCTGGGCTTTGTTGG + Intergenic
1130510825 15:84587935-84587957 GAGGAGGAGCTGGGCTTTGTTGG + Intergenic
1131183667 15:90257461-90257483 GAGTGTGTGCTGGGCTCCTCCGG - Intronic
1134766213 16:16760461-16760483 GTGGTTCTGCTGGGCTCTGTTGG + Intergenic
1135422626 16:22315205-22315227 GAGGGTGAGCGGGGCTTCGTGGG + Exonic
1137680345 16:50337702-50337724 AAGGGTGTGCTGGGCTCTCTTGG + Intronic
1139866350 16:70065525-70065547 GAGGCTGGGCGGGGTTCCGTGGG - Intergenic
1141629037 16:85276913-85276935 GAGAAGGTGCTGGGCAGCGTGGG + Intergenic
1141820662 16:86443235-86443257 GAAGATGTGCAGGGCTCAGGGGG + Intergenic
1141866311 16:86752332-86752354 GAGGATGTGATGAACTCCGAGGG - Intergenic
1142256974 16:89018758-89018780 GAGGCTGGGCTGGGCTCAGGAGG - Intergenic
1203138351 16_KI270728v1_random:1744547-1744569 GAGGGTGTGCTGACCTCAGTGGG + Intergenic
1142498450 17:319454-319476 GGGGAGGTGCTGGGCTTCCTGGG - Exonic
1143111401 17:4554956-4554978 GAGGGTGTGCTTGGTTCCGCAGG - Exonic
1144725014 17:17497331-17497353 GAGGCTGTGCTGTGCTCCCAGGG - Intergenic
1145772542 17:27504084-27504106 GATGTTGTGCTTGGCCCCGTGGG + Intronic
1147133061 17:38420091-38420113 GAGTGTGGGCTGGGCTCAGTGGG + Intergenic
1148851837 17:50559384-50559406 GCGGGTGTGCTGGGCGCCGGTGG - Intergenic
1151817521 17:76478658-76478680 GTGGATGTGCTGGGATCCCTGGG - Intronic
1152724438 17:81938236-81938258 GAGGATGCTCCGGGCTGCGTGGG - Intronic
1155407787 18:25508992-25509014 GAGGACGTGATGGGCTCTGCAGG + Intergenic
1158515915 18:58130136-58130158 GTGGCTGTGTTGGGCTCTGTTGG + Intronic
1158515952 18:58130374-58130396 GTGGCTGTGTTGGGCTCTGTTGG + Intronic
1158515960 18:58130426-58130448 GTGGCTGTGTTGGGCTCTGTTGG + Intronic
1160208302 18:76855808-76855830 GAGGCTGTGCTGGGCACTGCAGG - Intronic
1160782560 19:884331-884353 GATGACGGGCTTGGCTCCGTGGG + Intronic
1161561031 19:4972508-4972530 GGGGCTGTCCTGGGCACCGTAGG + Intronic
1161736740 19:5996190-5996212 GTGGACTTGCTGGGCTGCGTGGG - Intronic
1161884244 19:6981462-6981484 GAGGCTGTCCTGGGCACTGTAGG + Intergenic
1162104896 19:8364318-8364340 GAGGATGAGCGGTGCTCCGACGG + Exonic
1164864921 19:31596793-31596815 GAGGATATTCTGGGCTCCGCGGG + Intergenic
1164995871 19:32720205-32720227 GAGGCTGTGCGGGGCTGCGGTGG - Intronic
1165554955 19:36622548-36622570 GAGGCTGTGCTGAGCTTCGCTGG - Intronic
1202688199 1_KI270712v1_random:67183-67205 GGGGATGTGCTGACCTCAGTGGG - Intergenic
925231310 2:2236213-2236235 TGGGATGTGCTGGGCTGGGTTGG - Intronic
925231404 2:2236533-2236555 TGGGATGTGCTGGGCTGGGTTGG - Intronic
925231426 2:2236613-2236635 TGGGATGTGCTGGGCTGGGTTGG - Intronic
925905619 2:8538196-8538218 GAGAAGGAGCTGGGCTCAGTGGG - Intergenic
926225622 2:10965003-10965025 GACTCTGTGCTGGGCTCCCTGGG - Intergenic
926715285 2:15919372-15919394 GAGCTTGTGCTTGGCTCCCTGGG + Intergenic
927846518 2:26475143-26475165 GAGGATGTGCTGGCCTGGGAAGG + Intronic
927894965 2:26775725-26775747 GAGTCTGTGCTGGGCTCCCAAGG - Intronic
928815639 2:35292008-35292030 GATGCAGTGCTGGGCTCAGTGGG - Intergenic
932280701 2:70489399-70489421 CAGGATGTTCTGGGCTGCCTGGG + Intronic
932438265 2:71715968-71715990 GAGAAAGTGCTGGGCTTTGTGGG + Intergenic
933834419 2:86233796-86233818 GAGGGTGTGCAGGGTTCCCTCGG + Intronic
933958155 2:87388411-87388433 GGGGATGTGCTGACCTCAGTGGG + Intergenic
934242277 2:90280328-90280350 GGGGATGTGCTGACCTCAGTGGG + Intergenic
934270896 2:91536359-91536381 GGGGATGTGCTGACCTCAGTGGG - Intergenic
934949714 2:98567834-98567856 GTGGATGGGCTGGGACCCGTAGG + Intronic
935190815 2:100777555-100777577 AAGGATGAGCTGGGCTGCGAAGG - Intergenic
935195785 2:100815039-100815061 GGCGATGTGCTGGGCTGGGTGGG + Intergenic
937098405 2:119250509-119250531 GAGGCTCTGCGGGGCTCCCTGGG + Intronic
941110716 2:161416868-161416890 GAGGCTGTTGTAGGCTCCGTTGG - Exonic
942926304 2:181437043-181437065 GAGGATATGCTGAGCTGTGTGGG - Intergenic
946392205 2:219423339-219423361 GTGGGAGTGCTGGGGTCCGTGGG + Intronic
946409901 2:219510706-219510728 GAGAAGGTGCTGGGCTGGGTTGG + Intergenic
948036800 2:234864342-234864364 GGGGCTGGGCTGGGCTGCGTTGG - Intergenic
948853639 2:240720117-240720139 CAGGAAGTGCTGGGCTTGGTGGG + Intronic
1174442985 20:50570738-50570760 GTGGCTGTGCTGGGCGCTGTAGG + Intronic
1177146502 21:17412529-17412551 CAGCATGTGCTGGTCTCCATAGG + Intergenic
1179018483 21:37616168-37616190 GAGGATGTGCTTGGCTGCCATGG - Exonic
1179099948 21:38347662-38347684 GAGGATGTGCTGGGCTGAGGAGG - Intergenic
1179710812 21:43211957-43211979 GAGGATGTGCTGGTCTACCCGGG + Intergenic
1179951776 21:44712279-44712301 CAGGAGGGGCTGGGCTCCCTCGG + Intergenic
1180790700 22:18574079-18574101 GAGGAGGGGCTGGGCCCCGAGGG - Intergenic
1181231037 22:21421235-21421257 GAGGAGGGGCTGGGCCCCGAGGG + Intronic
1181247611 22:21513633-21513655 GAGGAGGGGCTGGGCCCCGAGGG - Intergenic
1181350797 22:22256611-22256633 GGGGATGTGCTGACCTCAGTGGG - Intergenic
1182519965 22:30879623-30879645 GGGGAAGTGCTGGGCTCCCCCGG - Intronic
1183279603 22:36924813-36924835 GAGGATGGGCAGGGCCCCGGGGG - Intronic
1183382128 22:37495571-37495593 TAGGAGCTGCTGGGCTCTGTGGG + Exonic
1184402506 22:44282153-44282175 GAGGCTGTGCCGGCCTCCGCTGG + Intronic
1184464605 22:44661348-44661370 CAGGAGGTTCTGGGCTCCTTTGG - Intergenic
1185194553 22:49460912-49460934 GAGGATGAGCTGGGTGCGGTGGG - Intronic
1185199658 22:49493976-49493998 GAGTATGGGCTGAGCTCCCTGGG + Intronic
950725120 3:14912238-14912260 CAGGGTGTGCTGGGCCCCGATGG + Intronic
951695081 3:25437997-25438019 GTGGATGGGCTGGGCTCCGCTGG + Intronic
952955616 3:38555601-38555623 GAGGATCTTCTGGGGTCCCTGGG - Intronic
953788730 3:45930356-45930378 GAGGTTGGGCAGGGCTCCATGGG - Intronic
953931618 3:47008635-47008657 GAGGATGTGCAGGGCGCACTGGG - Exonic
954712898 3:52513766-52513788 GAGGATGTGTAGGACACCGTTGG - Exonic
954931047 3:54281458-54281480 GAGGAAGTGCTGGGCTCTGAGGG + Intronic
955136792 3:56227033-56227055 GAGAATGTGGTGGGATCTGTAGG - Intronic
955175583 3:56610974-56610996 GAGGATGCAGTGGACTCCGTGGG + Intronic
958171874 3:89948423-89948445 GTTGCTGTGCTGGGCTCCGTGGG + Intergenic
961804495 3:129479584-129479606 GAGGCTGAATTGGGCTCCGTGGG + Intronic
965138577 3:164806471-164806493 GAGTATGCCCTGGGCTCTGTGGG + Intergenic
967220325 3:187242889-187242911 GGGGATATGCTGGGCTACCTGGG + Intronic
968527497 4:1069709-1069731 GAGGATGGTCTGGTCTCCGGAGG + Intronic
974009316 4:56592735-56592757 GGGGCTGTGCTGGGCGCCGTGGG + Intronic
975033576 4:69655184-69655206 AAGTTTGTGCTGGGCTCAGTTGG + Intergenic
984701040 4:182819052-182819074 GAGGCTGTGCTGGGCTCGAAGGG + Intergenic
986072003 5:4294686-4294708 GAGGAAGTGCTAGGCTTCTTAGG - Intergenic
990210852 5:53480502-53480524 GAGGGTGTGCGCGGCTCCTTGGG - Exonic
995240819 5:109884229-109884251 GAGGGTCCCCTGGGCTCCGTGGG - Intronic
997839525 5:137226492-137226514 GAGGATGAGGTGGCCTCTGTGGG - Intronic
1005019134 6:21401100-21401122 GAGGATGTGATTGGCTCTGAAGG + Intergenic
1006130323 6:31865229-31865251 GTGGGTGTGCTGTGCTCAGTCGG - Intronic
1007097580 6:39223341-39223363 GAGGATGTGCTGCCCTCAGTAGG - Intronic
1010285537 6:74073585-74073607 GACGATGAGCTGGGCTCCAGTGG + Intergenic
1015519413 6:134115380-134115402 TAGCACGTGCTGGGCTCCTTCGG + Intergenic
1017806176 6:157947381-157947403 GAGGCTGTGCTGTGCACTGTAGG - Intergenic
1018093193 6:160363020-160363042 GAGGCTGGGCTGGGCTCCCGGGG + Intronic
1020081384 7:5287808-5287830 GAGGCTGCCATGGGCTCCGTGGG + Exonic
1023265819 7:38404224-38404246 GAGGATGTGCTGAGCTCTTGGGG - Intronic
1024061721 7:45703449-45703471 GAGGAAGTGCTGGGCGACGTGGG - Exonic
1025041268 7:55647699-55647721 GAGGATGTGTTGGGCTAAGATGG - Intergenic
1025845417 7:65192380-65192402 GAGGGTGTCCTGGGCTCCCCTGG + Intergenic
1025895693 7:65698412-65698434 GAGGGTGTCCTGGGCTCCCCTGG + Intergenic
1027232745 7:76281974-76281996 GAGGAGGGGTTGGGATCCGTGGG - Intronic
1029004996 7:97199995-97200017 GCAGAAGTGCTGGGGTCCGTTGG + Intergenic
1029612857 7:101636621-101636643 GAGGATGAGCTGGGCCCTGCTGG + Intergenic
1029714365 7:102317908-102317930 GAGGAGGAGCTGGGCTGGGTGGG + Intronic
1032187808 7:129742439-129742461 GAGGATGGGCTGGGCAGAGTCGG - Intronic
1032262070 7:130346291-130346313 GAGGATGTGCTGGGTTGGGGAGG + Intronic
1033572283 7:142642246-142642268 GAGGATGTGGTGGGGGCTGTAGG - Intergenic
1034238240 7:149589417-149589439 GAGGATGGGCTGGGCTGGGCAGG + Intergenic
1035318988 7:158016205-158016227 GAGGATGGGCAGGGCTCGGGAGG + Intronic
1037721013 8:21444146-21444168 TAGGAGGTGCTGGGCACCGTGGG - Intergenic
1038805146 8:30783558-30783580 GAGGATAGGCTGGGCACAGTGGG - Intronic
1039335201 8:36581559-36581581 GAGGATGTGGTGGGTTCTCTTGG - Intergenic
1045548920 8:103152791-103152813 GTGGAGGAGCTGGGCTCCTTTGG + Intronic
1046152088 8:110240813-110240835 GAGGATGTCTTGAGCTCAGTGGG - Intergenic
1049683826 8:143931358-143931380 CAGGATGTTCTGGGCTGCATGGG - Intronic
1049738448 8:144222394-144222416 GTGGATGTGCTCAGGTCCGTAGG - Intronic
1056942329 9:90966277-90966299 TAGGGTGTGCTGGGTTCCCTGGG - Intergenic
1057125289 9:92611577-92611599 GAGGATGTGCTGGGCCGCAGGGG + Intronic
1057125669 9:92614160-92614182 GAAGGTGGGCTGGGCTCCCTAGG - Exonic
1057702031 9:97370304-97370326 GTGGGTGTGCTGGGTTCCGTGGG + Intronic
1058484970 9:105434622-105434644 AAGGATGTTCTGGGCTCCCAAGG + Intronic
1060991990 9:127854582-127854604 GAGGGGGTGCTGGGCTCCAATGG + Exonic
1061671035 9:132188279-132188301 GAGGATGAGAAGGGTTCCGTTGG + Intronic
1061826742 9:133262543-133262565 GAGGCTGTCCTGGCCTCCCTCGG - Intronic
1062439319 9:136562641-136562663 GGGGATGAGGTGGGCTCAGTGGG + Intergenic
1062481653 9:136755198-136755220 GAGGCTGGGCTGGGCCCTGTGGG - Intronic
1185533332 X:839215-839237 GAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533409 X:839555-839577 GAGGGTGTGCTGACCTCAGTGGG + Intergenic
1185533561 X:840235-840257 GAGGGTGTGCTGACCTCAGTGGG + Intergenic
1186000277 X:5001820-5001842 AAGTCTGTGCTGGGCTCAGTGGG + Intergenic
1186717670 X:12269716-12269738 GAGGATGCCCTTGGCACCGTGGG - Intronic
1188899559 X:35713150-35713172 GAGGGTGTGCTGGACTCCCAGGG - Intergenic
1192511466 X:71722803-71722825 GAGGATGGGCTTGACTCCTTGGG + Intergenic
1192515231 X:71758702-71758724 GAGGATGGGCTTGACTCCTTGGG - Intergenic
1197533919 X:127663879-127663901 GAGGAGTTGCTGGGCTGAGTAGG + Intergenic
1200038073 X:153346088-153346110 GAGGATCAGCTGGGCTCTCTGGG + Intronic
1200259078 X:154602410-154602432 CAAGCTGGGCTGGGCTCCGTCGG + Intergenic
1200684182 Y:6245253-6245275 GGGGATGTGCTGGGCTGTGCAGG - Intergenic
1200831336 Y:7690519-7690541 GAGGATGGGCTGGGCTGCACAGG + Intergenic
1201063769 Y:10070139-10070161 GGGGATGCGCTGGGCTGCGCAGG + Intergenic
1202115592 Y:21467163-21467185 GAGGATTAGCTGGACTCCATAGG - Intergenic