ID: 1077176275

View in Genome Browser
Species Human (GRCh38)
Location 11:1192406-1192428
Sequence TGCCACGGAGGCGGATACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077176275_1077176284 20 Left 1077176275 11:1192406-1192428 CCATGGTATCCGCCTCCGTGGCA 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1077176284 11:1192449-1192471 CTCTGTGGCATCCAGCTCTGTGG 0: 2
1: 1
2: 9
3: 122
4: 4583
1077176275_1077176282 5 Left 1077176275 11:1192406-1192428 CCATGGTATCCGCCTCCGTGGCA 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1077176282 11:1192434-1192456 CTCTGTGGCATCCAGCTCTGTGG 0: 2
1: 1
2: 9
3: 122
4: 4583
1077176275_1077176278 -10 Left 1077176275 11:1192406-1192428 CCATGGTATCCGCCTCCGTGGCA 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1077176278 11:1192419-1192441 CTCCGTGGCATCCACCTCTGTGG 0: 1
1: 0
2: 2
3: 122
4: 4375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077176275 Original CRISPR TGCCACGGAGGCGGATACCA TGG (reversed) Intronic