ID: 1077176275 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:1192406-1192428 |
Sequence | TGCCACGGAGGCGGATACCA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 69 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 61} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1077176275_1077176284 | 20 | Left | 1077176275 | 11:1192406-1192428 | CCATGGTATCCGCCTCCGTGGCA | 0: 1 1: 0 2: 0 3: 7 4: 61 |
||
Right | 1077176284 | 11:1192449-1192471 | CTCTGTGGCATCCAGCTCTGTGG | 0: 2 1: 1 2: 9 3: 122 4: 4583 |
||||
1077176275_1077176282 | 5 | Left | 1077176275 | 11:1192406-1192428 | CCATGGTATCCGCCTCCGTGGCA | 0: 1 1: 0 2: 0 3: 7 4: 61 |
||
Right | 1077176282 | 11:1192434-1192456 | CTCTGTGGCATCCAGCTCTGTGG | 0: 2 1: 1 2: 9 3: 122 4: 4583 |
||||
1077176275_1077176278 | -10 | Left | 1077176275 | 11:1192406-1192428 | CCATGGTATCCGCCTCCGTGGCA | 0: 1 1: 0 2: 0 3: 7 4: 61 |
||
Right | 1077176278 | 11:1192419-1192441 | CTCCGTGGCATCCACCTCTGTGG | 0: 1 1: 0 2: 2 3: 122 4: 4375 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1077176275 | Original CRISPR | TGCCACGGAGGCGGATACCA TGG (reversed) | Intronic | ||