ID: 1077177746

View in Genome Browser
Species Human (GRCh38)
Location 11:1198296-1198318
Sequence CCGTGGCTCTTACCTGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077177746_1077177750 1 Left 1077177746 11:1198296-1198318 CCTGTACCAGGTAAGAGCCACGG 0: 1
1: 0
2: 0
3: 9
4: 72
Right 1077177750 11:1198320-1198342 GCTCAGACCCCCTCAGCCATAGG 0: 1
1: 0
2: 1
3: 10
4: 166
1077177746_1077177758 27 Left 1077177746 11:1198296-1198318 CCTGTACCAGGTAAGAGCCACGG 0: 1
1: 0
2: 0
3: 9
4: 72
Right 1077177758 11:1198346-1198368 GGAGCTTCCCACTGACCCTGAGG 0: 1
1: 0
2: 0
3: 42
4: 378
1077177746_1077177751 2 Left 1077177746 11:1198296-1198318 CCTGTACCAGGTAAGAGCCACGG 0: 1
1: 0
2: 0
3: 9
4: 72
Right 1077177751 11:1198321-1198343 CTCAGACCCCCTCAGCCATAGGG 0: 1
1: 1
2: 1
3: 60
4: 737
1077177746_1077177752 6 Left 1077177746 11:1198296-1198318 CCTGTACCAGGTAAGAGCCACGG 0: 1
1: 0
2: 0
3: 9
4: 72
Right 1077177752 11:1198325-1198347 GACCCCCTCAGCCATAGGGACGG 0: 1
1: 0
2: 0
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077177746 Original CRISPR CCGTGGCTCTTACCTGGTAC AGG (reversed) Intronic
901254203 1:7807144-7807166 CCGTGGCACTTACCTGGCAGTGG + Intronic
902605153 1:17565019-17565041 CCGTGACTCTTACCAGCAACAGG + Intronic
906532619 1:46532399-46532421 CCGTGGCTCTGACTTGGGCCAGG - Intergenic
906619916 1:47267869-47267891 CAGTGACTCTTACCTGTAACTGG - Intronic
910272947 1:85417002-85417024 CAGTGGCTTTTACCGGGTAGTGG + Intronic
915271560 1:154757385-154757407 CTGTGGCTCTTATCTGGTAGTGG + Intronic
918039734 1:180906721-180906743 GTGTGGCTCTTACCTGGTCGGGG - Intergenic
918873560 1:190008887-190008909 ACCTGGCTCTGAGCTGGTACTGG - Intergenic
919087817 1:192942313-192942335 CCCTGGCTCGTACCTGTGACAGG - Intergenic
923735635 1:236604409-236604431 CTGTGCCGCTTACCTGGAACTGG + Exonic
924270900 1:242331594-242331616 CCGTGTCTCTTTCCAGGTTCAGG - Intronic
1062834848 10:628888-628910 CCGTGGTTCTCACCTGGGGCTGG - Intronic
1062841153 10:673036-673058 CCTTGGTTCTAACCAGGTACAGG - Intronic
1064137327 10:12762373-12762395 ACCTGGCTATTACCTGCTACTGG + Intronic
1076036301 10:127201303-127201325 CCGTGGCTCTTGCACGGTCCTGG + Intronic
1077077653 11:708713-708735 CCTTGGCTCTTTCCTGGGCCTGG - Intronic
1077177746 11:1198296-1198318 CCGTGGCTCTTACCTGGTACAGG - Intronic
1091513346 12:1152682-1152704 CTGTTGCTCTGACCAGGTACTGG - Intronic
1092114713 12:5991806-5991828 CCCAGGCTCCTACCTGGTGCTGG + Exonic
1093869910 12:24278067-24278089 CTGTGGCTCCTACCGTGTACAGG - Intergenic
1106643748 13:31611406-31611428 CCGTGCCTCTTATCTGGTCAAGG - Intergenic
1111795198 13:92910540-92910562 CCTTGGTTCTTACCTGGACCTGG - Intergenic
1115453459 14:33574879-33574901 TGGTGGCTCTCACCTGGTAAAGG + Intronic
1119525072 14:75316510-75316532 CCGTGGGTCTTACCTGTTTCTGG - Intergenic
1128239830 15:66094349-66094371 CCCTGGCTCTGACTTGGTAGGGG - Intronic
1128872062 15:71166573-71166595 CCCTGGCTCTGAGCTGGTCCTGG + Intronic
1129303035 15:74637497-74637519 CCCTGGCTCTTCCCTGGCACAGG + Intronic
1130529878 15:84738694-84738716 CCTTGGCTCATACCTGCCACTGG + Intergenic
1132338695 15:101064807-101064829 CCGTGGCACTAGCCTGGCACAGG - Intronic
1136375831 16:29864458-29864480 CCGTGGCTCAGACCTGGCACGGG - Intergenic
1145296643 17:21598255-21598277 CCGTGGGTCTTACCTGGCCCAGG + Intergenic
1147562041 17:41515293-41515315 CCTTGGCTGTTACCTGGGACAGG - Intronic
1152760315 17:82104023-82104045 CCGTGCCTCTGACCTAGGACTGG - Intronic
1160105007 18:75965706-75965728 CCGTGGAACTTAGCTGGTAGAGG + Intergenic
1161354729 19:3812548-3812570 CAGTGGCTCTTTCCTGGCTCGGG - Intronic
1162759697 19:12881313-12881335 CCGGGGCCCTGACCTGCTACGGG - Exonic
1162966819 19:14160078-14160100 CGGTGGCGCTGACCTGGTATGGG - Intronic
1163322952 19:16585341-16585363 CCTGGGCTCCTTCCTGGTACAGG - Intronic
1163473545 19:17511951-17511973 CCGTAGCTCTCACCCGGTAGAGG - Exonic
927694386 2:25230375-25230397 CCGTGGCTCTTGCCTGGGGGAGG - Exonic
934740168 2:96714809-96714831 CTCTGGCTGTTACCTGGAACTGG - Intronic
936145977 2:109980896-109980918 CCCTGGCTCTTCCCTGGCTCAGG + Intergenic
936198712 2:110390582-110390604 CCCTGGCTCTTCCCTGGCTCAGG - Intergenic
1169039154 20:2478871-2478893 CGGTGGCTCACACCTGGTGCTGG - Intronic
1173159891 20:40644556-40644578 CTGAGGCTCTCACCTGGTGCTGG + Intergenic
1174077121 20:47945583-47945605 CCCTGACTCATACATGGTACAGG + Intergenic
1176363219 21:6016133-6016155 CTGTGGTTCTTAGCTGTTACAGG + Intergenic
1177995290 21:28089600-28089622 CCCTGGCTCTGGGCTGGTACTGG + Intergenic
1178937408 21:36875266-36875288 CCGTGGACCTCACCTGGAACTGG - Intronic
1179760299 21:43522412-43522434 CTGTGGTTCTTAGCTGTTACAGG - Intergenic
949575008 3:5330715-5330737 CCTTGGCTCTGACCAGGTAGAGG - Intergenic
949926731 3:9047762-9047784 CCGTGGCCCTTACCTGACAAAGG - Intronic
954404345 3:50337160-50337182 CCCTGGCTCCCACCTGGTCCCGG + Intronic
961370122 3:126423743-126423765 CCGTGGCCCTGGCCTGGTCCAGG + Intronic
961724164 3:128915106-128915128 CCTTGCCTGTTACCTGTTACAGG + Exonic
965487333 3:169293863-169293885 CAGTGACTCTCACCTGTTACTGG - Intronic
988868727 5:35364293-35364315 CCCTGGCACATTCCTGGTACAGG + Intergenic
990374812 5:55158836-55158858 CCCTGGCTGTTGCCTGGCACAGG - Intronic
995301020 5:110582585-110582607 CCTTGGCTTGTTCCTGGTACAGG - Intronic
998464100 5:142329360-142329382 CCAAGGCTCTTTCCTGGTTCTGG - Intergenic
1010877997 6:81132444-81132466 ACCTGGCTTTTACCTGGGACTGG - Intergenic
1016907306 6:149164414-149164436 CTGTGGCTCTTGCCTGGGACTGG - Intergenic
1019928816 7:4210153-4210175 CCCCGGGTCTTACCTTGTACAGG - Exonic
1025228277 7:57181930-57181952 CCGTGGCTCATCCCTGTTAAAGG - Intergenic
1026556689 7:71414648-71414670 TCGTGGCTCTTCCCAGGAACAGG - Intronic
1031845291 7:126798618-126798640 CCTTGGCTCTTGCCTAGTAGCGG + Intronic
1034683828 7:152952208-152952230 CCGTGGCTCTTACCATGTCCTGG + Intergenic
1035035884 7:155893408-155893430 CAGCGGCTCTTCCCTGGTGCGGG + Intergenic
1035315217 7:157993390-157993412 TCCTGGCTCTGACCAGGTACGGG - Intronic
1035546296 8:484399-484421 CAGTGGCTCAGACCTGGTGCAGG + Intergenic
1039083223 8:33754969-33754991 ACCTGGCTCTGAGCTGGTACTGG + Intergenic
1039411442 8:37358396-37358418 CCCTGTCTCTTACCAGGCACTGG - Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1047032425 8:120896764-120896786 CCCTGGCTCTGGGCTGGTACTGG - Intergenic
1055003315 9:71478451-71478473 CAGTGGCTCTTACATTGTAAGGG - Intergenic
1057277934 9:93686146-93686168 CTGTGGCTCTTCACTGTTACAGG + Intergenic
1059512939 9:114865959-114865981 CAGTGGCTCTTAACTGGAAGTGG + Intergenic
1060205253 9:121678946-121678968 CCGTGGCTCAGCCCTGGTCCCGG + Intronic
1186861477 X:13676775-13676797 GAGTGGCTATTAACTGGTACTGG - Intronic
1187752921 X:22487251-22487273 CCTTGGCTCTTAGATGGAACAGG + Intergenic
1188618631 X:32191931-32191953 ATGTCCCTCTTACCTGGTACAGG - Intronic
1195863018 X:109401181-109401203 TAGTGGCTCTTACTTGGTTCTGG - Intronic