ID: 1077177795

View in Genome Browser
Species Human (GRCh38)
Location 11:1198501-1198523
Sequence CCCCGGAGCCAGGCAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 582}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077177795_1077177811 22 Left 1077177795 11:1198501-1198523 CCCTGGCCTGCCTGGCTCCGGGG 0: 1
1: 0
2: 4
3: 53
4: 582
Right 1077177811 11:1198546-1198568 CCTGGCACCACAGCACAGCCAGG 0: 1
1: 0
2: 2
3: 54
4: 433
1077177795_1077177812 27 Left 1077177795 11:1198501-1198523 CCCTGGCCTGCCTGGCTCCGGGG 0: 1
1: 0
2: 4
3: 53
4: 582
Right 1077177812 11:1198551-1198573 CACCACAGCACAGCCAGGCCTGG 0: 1
1: 0
2: 2
3: 57
4: 507
1077177795_1077177808 4 Left 1077177795 11:1198501-1198523 CCCTGGCCTGCCTGGCTCCGGGG 0: 1
1: 0
2: 4
3: 53
4: 582
Right 1077177808 11:1198528-1198550 CCGGGGGACTTTGCCTCTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077177795 Original CRISPR CCCCGGAGCCAGGCAGGCCA GGG (reversed) Intronic
900119812 1:1043743-1043765 CCCTGGGGCCGGGCGGGCCAGGG + Intronic
900177148 1:1295928-1295950 CCCCTGGTCCAGGCAGGACAAGG - Exonic
900313266 1:2044873-2044895 CCCCGGAGCCAGAGCGGGCAGGG + Intergenic
900470815 1:2854102-2854124 CCCCAGGCCCAGGCTGGCCAGGG + Intergenic
900484492 1:2914990-2915012 CCCCGGAGCTAAGCCAGCCATGG - Intergenic
900807399 1:4776444-4776466 TCCCGGAGCCAGGCAGCCATCGG - Intronic
900908676 1:5578645-5578667 CCCCGGATCCAGGTGGGTCATGG + Intergenic
900931792 1:5742432-5742454 CCCCTGTGCCAGGCAGCGCATGG - Intergenic
900954417 1:5877801-5877823 CCTGGGGGCCAGGCAGTCCAGGG - Intronic
900990190 1:6095149-6095171 CCTGGGAGCCAGGCAGGCCCTGG - Intronic
901026842 1:6282846-6282868 CCCGGGAGGAGGGCAGGCCATGG + Intronic
901029458 1:6298610-6298632 TCCGGGTGCCAGGCAGGGCAGGG + Intronic
901369362 1:8783249-8783271 CACCTGAGCCAGGGAGGTCAAGG + Intronic
901490314 1:9593332-9593354 CCCAAGAGGCAGGTAGGCCAGGG - Intronic
901497490 1:9630245-9630267 CCCCGGAGGCCGTCAGGCCTTGG + Intergenic
902226222 1:14998072-14998094 CCCAGGAGCAGGGCAGGCCTCGG + Intronic
902799654 1:18821322-18821344 CCCAGGAGGCAGGCAGGCTGGGG + Intergenic
902878913 1:19358008-19358030 CTCCTGAGCCTGGCAGACCAGGG + Intronic
903023898 1:20413415-20413437 CCCTGGAGCTCGGCTGGCCAGGG - Intergenic
903252904 1:22069539-22069561 CACCTGAGCCAGGAAGGTCAAGG - Intronic
903670581 1:25033244-25033266 ACGTGGAGCCAGGCAGGCCTGGG - Intergenic
903745162 1:25581822-25581844 CCCCAGAGCCAGGCAGGAGGGGG + Intergenic
904475522 1:30762308-30762330 CCCCTCAGCCAGGCAGTCCAGGG + Intergenic
904615801 1:31748959-31748981 CTCTGGAGTCAGGCAGGCCTGGG - Intronic
904954758 1:34273592-34273614 CCCTGGAGCCAGGCTGTCTATGG + Intergenic
905879415 1:41453951-41453973 GCCTGGAGTCAGGCAGGCCTGGG + Intergenic
906406574 1:45547136-45547158 CACCTGAGCCTGGGAGGCCAAGG - Intergenic
906610235 1:47196685-47196707 GCCCAGAGCCAGTCAAGCCAAGG + Intergenic
906729805 1:48071227-48071249 CCCCTGAGAAAGGCAGGCGATGG + Intergenic
907306075 1:53513838-53513860 CCCCAGGCGCAGGCAGGCCATGG + Intronic
907310638 1:53537123-53537145 CCCAGGAGCCAGGCAGGGGGTGG + Intronic
907458981 1:54594092-54594114 CCCCTGAGCCAGACTCGCCATGG - Intronic
908538398 1:65100150-65100172 CGCTTGAGCCTGGCAGGCCAAGG + Intergenic
910933700 1:92467882-92467904 CACCTGAGCCAGGGAGGTCAGGG + Intergenic
910981107 1:92961138-92961160 CCCTGGAGCCCGGCTGGCCGCGG + Intronic
911375348 1:97044561-97044583 CCCGGGTGCCAGGGAGCCCAGGG + Intergenic
912473882 1:109923811-109923833 CCCCGGAGCCAGGCTCTCCCAGG + Exonic
912626864 1:111212687-111212709 CACCCCAGCCAGGGAGGCCAGGG - Intronic
913453176 1:119006720-119006742 CGCCGGAGCCAGGCGGGAAAGGG + Intergenic
915117964 1:153612269-153612291 CTCAGGACCCAGGCAGGCCCCGG - Intronic
915204960 1:154263255-154263277 TCCCCAAGCCACGCAGGCCATGG - Intronic
916170992 1:162001542-162001564 CTCTGGAGGCAGGCAGTCCAGGG - Intronic
916786712 1:168092016-168092038 CCCTGGAGCCAAGGAGGACATGG + Intronic
917927865 1:179803961-179803983 GCCTGGAGGCAAGCAGGCCAGGG - Intronic
919768422 1:201141910-201141932 CCCCAGAGCCATGCATTCCACGG + Intronic
920038257 1:203079701-203079723 CACCGGAGTCAGGAAGGCCTAGG - Intergenic
922565209 1:226597129-226597151 CCCCAGTGCCAAGCAGCCCAGGG - Intronic
923605275 1:235437734-235437756 CACCTGAGCCCGGGAGGCCAAGG + Intronic
1062877682 10:955330-955352 CACAGGCGCCAGGCAGGCTATGG + Intergenic
1064044327 10:11998464-11998486 CCCTGGAGCCTGGCAGAGCAAGG - Intronic
1065097952 10:22301117-22301139 CCTCGGAGCCAGACAGACCTGGG + Intergenic
1065877375 10:30009182-30009204 GCCCAGAGACAGGCAGTCCAGGG - Intergenic
1066066993 10:31769186-31769208 CCCTTGAGCCTGGGAGGCCAAGG - Intergenic
1066349826 10:34627109-34627131 CCCCTGAGCCAAGGAGGTCAAGG - Intronic
1067669686 10:48307208-48307230 CCCCGGAGGCAGCCAGGGCGCGG - Intronic
1067684327 10:48457834-48457856 CCCAGCAGGCAGGCAGGCTATGG + Intronic
1067815961 10:49477038-49477060 CCCTGGAGCAGGACAGGCCATGG - Intronic
1068669705 10:59710197-59710219 CCCGGGAGCCAGGGAGACCAAGG - Intronic
1068888971 10:62128470-62128492 CACAGGAGCCAATCAGGCCAAGG - Intergenic
1068946913 10:62738819-62738841 CCTCAGGGCCAGGCAGGCCATGG + Intergenic
1069615567 10:69804068-69804090 CCCTGGAGCCTGGCAGGGCGTGG - Intronic
1069625067 10:69862704-69862726 CCCGGGAGGCAGGCAGACCTGGG + Intronic
1069836925 10:71315080-71315102 CCCTGGAGCCAGACAGACCTGGG - Intergenic
1069844481 10:71361741-71361763 CCGCGCTGGCAGGCAGGCCAGGG + Intronic
1071274998 10:84045600-84045622 CCCAAGCACCAGGCAGGCCACGG - Intergenic
1072323734 10:94275750-94275772 CACCTGAGCCTGGGAGGCCAAGG + Intronic
1072425202 10:95324234-95324256 CCCTGGAGTCAGGCAGGACAGGG + Intronic
1073352174 10:102827791-102827813 CCCTGGTGCCAGCCAGACCAGGG - Intergenic
1073512328 10:104050569-104050591 CCCAGGAGTGAGGCAGGCCCTGG + Intronic
1073634410 10:105182777-105182799 CCCCTGAGCCTGGGAGGTCAAGG - Intronic
1073929034 10:108552890-108552912 CCACAGATCCAGGAAGGCCAGGG + Intergenic
1075423985 10:122327554-122327576 CCCCCGAGGCAGGCAGACCAGGG - Intronic
1075448851 10:122533414-122533436 CACCTGAGCCAGGGAGGTCAAGG - Intergenic
1076058976 10:127398475-127398497 CACAGGAGCCAGGGAGGCCCAGG - Intronic
1076314425 10:129530829-129530851 GCGAGGAGCCACGCAGGCCAGGG - Intronic
1076510782 10:131012393-131012415 CCCAGGAGCCAGCCAGGCCCTGG + Intergenic
1076631767 10:131856057-131856079 CCCTGGGGACAGGCGGGCCATGG - Intergenic
1076800531 10:132826006-132826028 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800546 10:132826069-132826091 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800555 10:132826107-132826129 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800564 10:132826145-132826167 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800574 10:132826183-132826205 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800584 10:132826221-132826243 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800594 10:132826259-132826281 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800609 10:132826322-132826344 CCACGGAGCCAGGCAGGAACTGG + Intronic
1076800633 10:132826436-132826458 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800648 10:132826499-132826521 CCACGGAGCCAGGCAGGAACCGG + Intronic
1076800658 10:132826537-132826559 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800678 10:132826613-132826635 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800698 10:132826689-132826711 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076994244 11:290486-290508 CCCCGGGGCCAGGCGGGCGATGG - Exonic
1077034676 11:488875-488897 CCCCTGCGCCAGGCCGGCCAGGG - Intronic
1077045906 11:545043-545065 CCCGGGAGTCAGGCTGGCCCAGG - Intronic
1077177795 11:1198501-1198523 CCCCGGAGCCAGGCAGGCCAGGG - Intronic
1077221591 11:1420426-1420448 CCCTGGAGACAGGCAGGCCCAGG + Intronic
1077367149 11:2165862-2165884 GCCAGGATGCAGGCAGGCCAGGG + Intronic
1077508089 11:2941385-2941407 ACTCAGAGCCAGGCAAGCCAAGG + Intergenic
1077614955 11:3667816-3667838 CCCCGGAGGCCGGGAGCCCAGGG + Intronic
1080403524 11:31958320-31958342 CCCGGTAGCCTGGCCGGCCAAGG + Intronic
1080771657 11:35347695-35347717 GCCCTGAGCCAGGCAGGCACTGG + Intronic
1081813262 11:45924856-45924878 CCCCGGCCCAAGGCAGGCCAGGG - Exonic
1081933078 11:46886053-46886075 CCAGGGAGCCAGGCAGGCCACGG + Intronic
1082010672 11:47447994-47448016 CCCTGGTACCAGGCAGCCCAAGG + Exonic
1083179947 11:60978747-60978769 CCCCGGAGTCAGGCAGACGCGGG + Intronic
1083204636 11:61140918-61140940 CCCCAGAGCCAGGTCGGACACGG + Intronic
1083267474 11:61553449-61553471 CCCCGAGGCCAGGAAGGGCACGG + Intronic
1083301184 11:61740323-61740345 CCCTGCTGCCAGGCAGGCCAGGG + Intronic
1083334622 11:61915399-61915421 CCCTGGAGGCACCCAGGCCAAGG - Intronic
1083340360 11:61955242-61955264 CCCAGGCTCCAGACAGGCCAGGG + Intronic
1083384383 11:62296774-62296796 CTCTGAAGCCAGGCAGGGCAGGG + Intronic
1083503459 11:63133111-63133133 CCACCGAGCCAGGCATGCGAGGG + Intronic
1083677515 11:64334764-64334786 CCCTTGAGCCAGGAAGGTCAAGG - Intergenic
1083776544 11:64896861-64896883 CCCAGGAGCCTGGCAGGGCAGGG + Exonic
1083837060 11:65277259-65277281 CACCTGAGCCTGGAAGGCCAAGG - Intronic
1084013522 11:66365771-66365793 CCCTGGAGGCGTGCAGGCCAGGG - Intronic
1084340857 11:68499650-68499672 CCCTTGAGCCAGGAAGGTCAAGG - Intronic
1084795019 11:71499684-71499706 CCCCTGCGCTAGGGAGGCCATGG - Intronic
1085033915 11:73288935-73288957 CCCAGCAGGCAGGCAGGCCAAGG + Intronic
1085041759 11:73330962-73330984 CTCTGGATCCAGGAAGGCCAGGG + Intronic
1085572193 11:77569216-77569238 ACATGGAGCCAGGGAGGCCAAGG - Intronic
1086329123 11:85735671-85735693 CCCCGGAACCCGGGAGGCGAAGG + Intronic
1086348533 11:85922235-85922257 CCCTTGAGCCTGGCAGGCTAAGG - Intergenic
1088297548 11:108317015-108317037 CCCTTGAGCCAGGGAGGTCAAGG - Intronic
1088998116 11:115021274-115021296 CACCTGAGCCTGGGAGGCCAAGG - Intergenic
1089060268 11:115620633-115620655 CACTGGAGCCCGGGAGGCCAAGG - Intergenic
1089350394 11:117818732-117818754 ACCAGGAGCCAGGCAGGGGAAGG - Intronic
1089456410 11:118628297-118628319 CCCCGGCGCTGGGCAGCCCATGG + Exonic
1090859020 11:130636603-130636625 CTTTGGAGCCAGTCAGGCCAGGG - Intergenic
1092757215 12:11774904-11774926 CCCCGGGGTCAGGCAGGACAAGG + Intronic
1092842217 12:12553624-12553646 CACCTGAGCCTGGCAGGTCAAGG - Intronic
1094479624 12:30871443-30871465 CACTTGAGCCAGGGAGGCCAAGG - Intergenic
1094545843 12:31404139-31404161 CCCTTGAGCCAGGGAGGTCAAGG + Intronic
1095943738 12:47741763-47741785 CCACGCAGCCACGCAGCCCAGGG + Intronic
1096138645 12:49224147-49224169 CTCCTGAGCCTGGCAGGTCAAGG + Intronic
1097865156 12:64553891-64553913 TCCCTGAGCCTGGGAGGCCAAGG + Intergenic
1098453160 12:70643215-70643237 CACCTGAGCCTGGGAGGCCAAGG - Intronic
1100356817 12:93838840-93838862 CACCTGAGCCAGGGAGGTCAAGG - Intronic
1100711385 12:97260786-97260808 CTACGGAGGCAGGCACGCCATGG - Intergenic
1101414030 12:104493348-104493370 CCCTGGAACCAGGTAGGCCTTGG + Intronic
1102030989 12:109740010-109740032 CCCTGCAGCCAGACAGGCGAGGG + Intronic
1102046535 12:109833261-109833283 CCCCGGAGCCGGACGGGCCACGG + Intronic
1102179779 12:110903700-110903722 CCCCTGAATGAGGCAGGCCAGGG + Intronic
1102463965 12:113117205-113117227 GACCTGAGCCAGGCAGGGCAGGG - Intronic
1103224066 12:119271504-119271526 CACCTGAGCCTGGGAGGCCAAGG + Intergenic
1103403034 12:120656023-120656045 ACCAGGAGCCAGGCTGGGCAGGG + Intronic
1103925679 12:124422384-124422406 GCAAGGGGCCAGGCAGGCCAGGG + Intronic
1103944499 12:124518451-124518473 CCCCAAACCCGGGCAGGCCAAGG + Intronic
1104090547 12:125513098-125513120 CTGCGTAGGCAGGCAGGCCAGGG - Intronic
1104405068 12:128510360-128510382 CCCTGAAGGCTGGCAGGCCAGGG + Intronic
1104886892 12:132115685-132115707 CCCCAGAGCCAGCGAGGGCACGG - Intronic
1104965779 12:132508268-132508290 CCCTGGAGGCAGGCAGCCCCGGG + Exonic
1104987724 12:132606306-132606328 ACCAGGTGCCAGGCAGGACAAGG - Intronic
1104990744 12:132622559-132622581 CCCCACAGCCAGCCAGGCCACGG + Intergenic
1105000240 12:132686339-132686361 CACCTGAGCCCGGCAGGTCAAGG - Intronic
1106479108 13:30123678-30123700 CCCAGGAGCCAGGGAGAACATGG - Intergenic
1107832972 13:44390719-44390741 TGCCGGAGACAGGCAGGGCAAGG - Intronic
1112029266 13:95442065-95442087 CACCTGAGCCAGGGAGGTCAAGG + Intronic
1113416547 13:110132779-110132801 GCCTGGAGCCAGGGAGGCCAGGG + Intergenic
1113421834 13:110176939-110176961 CCATGGAGCCAGGCTTGCCAGGG + Exonic
1114453045 14:22838740-22838762 GCCCAGCGCCAGACAGGCCATGG - Intronic
1115378202 14:32702731-32702753 GGCCAGAGCCAGCCAGGCCAGGG - Intronic
1118686887 14:68300287-68300309 CACTGGAGCCTGGGAGGCCAAGG - Intronic
1118725505 14:68625946-68625968 CCCAGGAGCCAGCCACACCATGG - Intronic
1118734128 14:68690099-68690121 GCTCGGTCCCAGGCAGGCCAGGG + Intronic
1119459637 14:74789465-74789487 CCCAGCACCCAGGGAGGCCAAGG - Intronic
1119531213 14:75362589-75362611 CACCTGAGCCAGGGAGGTCAAGG - Intergenic
1119630067 14:76222521-76222543 CACCTGAGCCAGGGAGGTCAAGG + Intronic
1120192789 14:81454257-81454279 CCCCTTAGCCAGGAAGGGCAGGG - Intergenic
1121020197 14:90575368-90575390 CCCTGGAGCCAGGCTGGCCTGGG - Intronic
1121308989 14:92924608-92924630 GGCCAGAGCCAGGCAGGCAAAGG - Intronic
1121439016 14:93937128-93937150 CCCTGGAGCCAGCCTTGCCAGGG - Intronic
1121525212 14:94614689-94614711 CCCCAGAGACAGGAAGGCCAAGG - Exonic
1122023124 14:98855846-98855868 CCCTGCAGCCAGGCAGGACCTGG + Intergenic
1122128870 14:99593674-99593696 CCACAGAGCCTGGCTGGCCAGGG - Intronic
1122155361 14:99747338-99747360 CCCAGGAGAAAGGCAGGCCCGGG + Intronic
1122211036 14:100174365-100174387 CACCTGAGCCTGGGAGGCCAAGG + Intergenic
1122440184 14:101726476-101726498 CACTGGAGCCAGGGAGGTCAAGG + Intergenic
1122625753 14:103084572-103084594 CCCTGGCGCCGGGCAGGGCAAGG + Intergenic
1122660749 14:103293394-103293416 CACCTGGGCCAGGGAGGCCAAGG + Intergenic
1122816179 14:104315298-104315320 CCCCAGAGCCAGGCTGGCAGGGG - Intergenic
1122914114 14:104848927-104848949 CCCTTGAGCCAGGCAGTTCAAGG - Intergenic
1122974985 14:105167415-105167437 CCCCGGTCCCGGGCAGGCCGCGG - Intronic
1123403145 15:20005426-20005448 TGTCAGAGCCAGGCAGGCCAGGG + Intergenic
1123512484 15:21012080-21012102 TGTCAGAGCCAGGCAGGCCAGGG + Intergenic
1124621017 15:31273953-31273975 CCCCAGGGCCATCCAGGCCAGGG + Intergenic
1125751295 15:42031049-42031071 CACTGGAGCCAGGGAGGTCAAGG - Intronic
1127282870 15:57506597-57506619 CCCCAGAGCCAGCCAGGGAAGGG - Intronic
1127829721 15:62739640-62739662 ACCTGGAAACAGGCAGGCCATGG + Intronic
1128327088 15:66730867-66730889 CTCTGGAGGCAGGCAGGCCTGGG - Intronic
1128501477 15:68229919-68229941 TCCCGTACCCAGGCAGGCAAGGG - Intronic
1128776370 15:70323467-70323489 CCCAGGAGCTGGGCAGGCCGAGG - Intergenic
1128865725 15:71114296-71114318 CCCCAGAGCCAGGCAGCACCAGG - Intronic
1129162217 15:73753159-73753181 CCCGGGAGCCCGGCGGGGCAGGG - Intergenic
1129244820 15:74272708-74272730 CACCTGAGCCTGGCAGCCCAGGG - Intronic
1129281377 15:74487831-74487853 CCTCAGAACCAGGGAGGCCAAGG + Intergenic
1129298012 15:74610371-74610393 CTCCTGCTCCAGGCAGGCCAGGG + Intronic
1129411535 15:75353184-75353206 CCCATGAGACAGGCAGGACAAGG + Intronic
1129539227 15:76337717-76337739 GCCCGGACCCAGGCCGGCCTCGG - Intronic
1129608940 15:77038132-77038154 CTTCGGAGCCAGGCAGGCCCAGG + Intergenic
1129666707 15:77583247-77583269 CACCAAAGCCAGGAAGGCCAAGG - Intergenic
1129848276 15:78777942-78777964 CCCTGGAGCCAGGCCCGACAAGG + Intronic
1129872066 15:78946912-78946934 CTCCTGAGCCTGGGAGGCCAAGG - Intronic
1129875557 15:78973273-78973295 CCCCCCAGCCAGGCAGGGGAAGG - Intronic
1130253650 15:82315994-82316016 CCCTGGAGCCAGGCCCGACAAGG - Intergenic
1130303784 15:82699582-82699604 CCACACAGCCAGGAAGGCCAGGG - Intronic
1131827238 15:96331405-96331427 CCAGGGAGCCAGGCAGGCCGGGG - Exonic
1132092800 15:98959453-98959475 CCCGGGATCCAGGCTGGCCCAGG + Exonic
1132104124 15:99050598-99050620 CCCCAGAGCCACACAGGGCATGG - Intergenic
1132368615 15:101277233-101277255 CGCCGGAGCCTGGGAGGCCTGGG - Intronic
1132600194 16:769693-769715 CCCTAGAGCCAGACAGGCCTGGG + Intronic
1132634739 16:938224-938246 TCCCTGTGCCAGGCAGGCCATGG - Intronic
1132855281 16:2042202-2042224 GCCCGCAGCCAGGCAGGGAACGG - Intronic
1132866864 16:2097390-2097412 GCACGGGGCCAGGCGGGCCATGG - Exonic
1132885690 16:2181076-2181098 CCCCCGTGCCTGGCAAGCCACGG - Exonic
1132925851 16:2428905-2428927 CCCGGGACCCGGGCAGGGCACGG + Intergenic
1132942809 16:2516561-2516583 CGTCAGTGCCAGGCAGGCCAAGG - Intronic
1132974737 16:2705662-2705684 CCCCACAGGCAGGCAGGCCCGGG - Intronic
1133007931 16:2894975-2894997 TCCAGGACCCAGGCAGGACAAGG - Intronic
1133340696 16:5033793-5033815 CCCCCGAACCAGGCTGGCCCAGG + Intronic
1133639319 16:7701572-7701594 CCCTGGTGCCAAGAAGGCCAGGG + Intronic
1134038617 16:11050914-11050936 CCCTGGAGCAAGACAGGCCTGGG + Intronic
1135111078 16:19691294-19691316 CCCCGCGGCCATGCTGGCCAGGG - Intronic
1136065025 16:27753062-27753084 CCTCGCAGCCAGGCAGAGCATGG + Intronic
1136172741 16:28498313-28498335 CCCCGGTGCCAGCCAGGAGAAGG + Exonic
1136374083 16:29854830-29854852 CATGGGAGTCAGGCAGGCCAAGG + Intergenic
1137487795 16:48906233-48906255 CCCCGGAGCCAAGGAGTCCTTGG + Intergenic
1137615750 16:49845919-49845941 CCCCTGAGAAAGGCAGGACATGG + Intronic
1137666447 16:50252345-50252367 CCCCGAAGCCAGGCTGGCGGGGG - Intronic
1137716192 16:50599765-50599787 GCCCAGAGCCAGGCAGGGCACGG - Intronic
1138586867 16:57976268-57976290 CCCTGGAGGTAGTCAGGCCAAGG - Intergenic
1139330974 16:66189659-66189681 ACCCGAAGCCAGACAGCCCAAGG + Intergenic
1139354618 16:66360163-66360185 CCAGTGAGCCAGGCAGGGCAGGG - Intergenic
1139360548 16:66396830-66396852 CCCAGGAGCCCGCTAGGCCAAGG + Intronic
1139495596 16:67314937-67314959 CGCCTGAGCCAGGGAGGTCAAGG - Intronic
1139687024 16:68611809-68611831 CCCCTGAGCCTGGGAGGTCAAGG + Intergenic
1139913363 16:70412558-70412580 CACCTGAGCCTGGCAGGTCAAGG + Intronic
1140091966 16:71846129-71846151 CGCCGGGGCCAGGCAGGCCTGGG + Intronic
1140457843 16:75115071-75115093 CCCCAGAGGCAGGCAGCCCACGG + Intronic
1140966757 16:79973876-79973898 ACCTGGAGTCAGGCAGACCAAGG - Intergenic
1141425204 16:83940373-83940395 CCCCAGAGCCCAGCAGGACAAGG - Intronic
1141618019 16:85221135-85221157 GCCCAGAGGCAGGGAGGCCAGGG + Intergenic
1142103760 16:88291096-88291118 ACCTGGAGCCAAGCAGGCCAAGG + Intergenic
1142163167 16:88569957-88569979 GCGGGGAGCCAGGCAGCCCACGG + Intergenic
1142638069 17:1270215-1270237 CCCCAGAGCTAGGCAGGGCAAGG + Intergenic
1143177171 17:4962489-4962511 CCCTTGAGCCAGGGAGGTCAAGG - Intronic
1143266181 17:5639692-5639714 CGTCTGAGCCAGGCAGGCAAGGG + Intergenic
1143360822 17:6369217-6369239 CACCTGAGCCAGGGAGGTCAAGG - Intergenic
1143837513 17:9703780-9703802 CCCTGGAGCCAGGGTGGCCCAGG - Intronic
1144438991 17:15264772-15264794 ACCCAGAGCCCGGCTGGCCAAGG + Intronic
1144612467 17:16734054-16734076 CACCTGAGCCCGGGAGGCCAAGG + Intronic
1144732455 17:17536613-17536635 CACAGGAGCCAGCCAGGGCATGG - Intronic
1145013419 17:19382319-19382341 TGCTGGAGCCAGGCAGCCCAGGG - Exonic
1145132182 17:20364446-20364468 CACCTGAGCCCGGGAGGCCAAGG + Intergenic
1146156819 17:30531158-30531180 GCCAGGAGCCAGGCAAGCAAAGG - Intergenic
1146401079 17:32500509-32500531 GCTGGGAGTCAGGCAGGCCAGGG - Intronic
1146473744 17:33145179-33145201 CCCAGGAGACTGGCAGGCCTGGG + Intronic
1147444445 17:40466424-40466446 CCTCGGTTCCAGGCAGACCACGG - Intergenic
1147572030 17:41577219-41577241 CTTCGAAGCCAGGCAGGTCATGG + Intergenic
1147986603 17:44310654-44310676 CCATGGAGACAGGGAGGCCAGGG - Intronic
1148095939 17:45052200-45052222 CCCCGGAGCCGGGAAGGAGAGGG + Intronic
1148124106 17:45228165-45228187 CCGAGGAGCCAGGCACTCCAGGG - Intronic
1148929912 17:51120174-51120196 CCCGGGAGCCAGGCCGGCGTTGG - Intronic
1149555236 17:57568906-57568928 CCCCGGTACCAGCCAGGCCCAGG - Intronic
1150211785 17:63445983-63446005 CCCGGCACCCGGGCAGGCCAGGG + Exonic
1150338375 17:64346107-64346129 CCACCTAGCCAGGCAGGCCTGGG - Intronic
1151213637 17:72562638-72562660 CCCCGGGGCCAGGCAGGAATGGG + Intergenic
1151597963 17:75089274-75089296 CCCAGGGGGCAGGCAGGCCCAGG - Exonic
1151698754 17:75731458-75731480 CCCTGGAGTCAGGCAGGCCTGGG + Intronic
1151827131 17:76529805-76529827 CCCAGGTCTCAGGCAGGCCAGGG + Intronic
1152290371 17:79436830-79436852 CCTCAGAGCCAGGGAGCCCAGGG + Intronic
1152316151 17:79581584-79581606 CCTCGGGGCAAGGCAGGCCAAGG - Intergenic
1152386151 17:79975965-79975987 CAACGGAGCCAGTCAGGGCATGG + Intronic
1152467912 17:80476137-80476159 CCCCGGAGCCGGCGAGGCCCGGG - Exonic
1152563399 17:81089692-81089714 CCCCGGAGCCCGGCAGGGTCAGG + Intronic
1152564496 17:81094094-81094116 CCCCGGGGCCAGGGCAGCCAGGG + Intronic
1152744397 17:82032203-82032225 CCCCGGAGCCCGGCCTGCCCAGG + Intronic
1155242040 18:23872947-23872969 CACCTGAGTCAGGCAGGCCCGGG + Intronic
1155286006 18:24289740-24289762 CCCTGGAGCCAGGCTGCCCAGGG + Intronic
1160337289 18:78053847-78053869 GGACAGAGCCAGGCAGGCCATGG + Intergenic
1160837806 19:1132785-1132807 CCCCAGATCAAGGGAGGCCACGG - Intronic
1160865048 19:1252715-1252737 CCTCGGGGCCAGGGAGGCCCGGG - Intronic
1160934168 19:1585350-1585372 CCCCAAACCCAGGCAGGCCCTGG + Intronic
1161071707 19:2265540-2265562 CCCCTGAGCCAGGAAGGTCAAGG - Intronic
1161089100 19:2351390-2351412 CACCTCAGCCAGGCAGGCCAGGG - Intronic
1161153488 19:2721169-2721191 CCCCGGAGCCACGCGGGGAAGGG + Intronic
1161201067 19:3015134-3015156 CCCCGGAGACTGGCAGGCTCAGG - Intronic
1161377860 19:3949448-3949470 CCCAGGTGACAGGCAGCCCATGG + Intergenic
1161456874 19:4373979-4374001 GCCAGGAGTCAGGCAGGGCAGGG - Intronic
1161617979 19:5282868-5282890 CACTGGAGCCAGGTAGGCCTGGG - Intronic
1161777516 19:6271773-6271795 GCCGGGAGCCAGCCAGACCATGG + Intronic
1161977652 19:7615353-7615375 CCGCGGTGGCAGACAGGCCAAGG - Intronic
1162036085 19:7940317-7940339 CCCTGGAGAAAGGCTGGCCAGGG - Intronic
1162073238 19:8167530-8167552 CACAGGAGCCAGGTAGGGCAGGG + Intronic
1162148069 19:8625526-8625548 CACTGGAGCCAGGGAGGTCAAGG + Intergenic
1162336412 19:10063416-10063438 ACCCGGAGCCAGTCAGGCACAGG + Intergenic
1162780005 19:13002089-13002111 CCCCACAGCCAGGCAGGCCCTGG + Intronic
1163490912 19:17616748-17616770 CCCCCGATCCAGCCAGCCCAAGG - Intronic
1163513835 19:17751359-17751381 CCCTGGAACCACACAGGCCATGG - Intronic
1163630911 19:18417595-18417617 CCCCGGAGCCTGGGGGACCACGG - Intergenic
1164638291 19:29807282-29807304 CCCCCCAGCCAGCCAGGCAAGGG - Intergenic
1165058633 19:33194452-33194474 CCCCGGGCCCAGGCCGGCCGCGG + Intronic
1165111360 19:33504336-33504358 CCCTGAGGCCAGGCTGGCCAGGG + Intronic
1165172823 19:33906025-33906047 CTCCGGGGCCAGGCAGACCGTGG - Intergenic
1165691666 19:37868490-37868512 CACCTGAGCCAGGGAGGTCAAGG + Intergenic
1165901397 19:39170959-39170981 CCACAGAGCCAGGCAGGGCGTGG - Intronic
1165941553 19:39417013-39417035 CCCTGGAGCCAGGCTGGGGAGGG + Intronic
1166383713 19:42369019-42369041 CGCTGGGGCCAGGCAGGCTAGGG + Intronic
1166745469 19:45139994-45140016 CACTGCAGCCAGGCAGGCCTGGG - Intronic
1166887473 19:45971008-45971030 CTCCGGAACCAGGCAGCCTAGGG + Intronic
1167023453 19:46896294-46896316 CACCGGAGCCCGGGAGGTCAAGG + Intergenic
1167345276 19:48941755-48941777 CCCTGGAGCCTGGGAGGTCAAGG - Intronic
1168145504 19:54418268-54418290 CCCGGAAGACAGGCAGGCCGCGG - Intronic
1168271273 19:55251096-55251118 TGCTTGAGCCAGGCAGGCCAGGG - Intronic
1168343880 19:55641227-55641249 CGCCGGGGCCAGGCAGGCTGGGG + Intronic
1168721406 19:58556780-58556802 TCCTGGAGCCAGGTGGGCCAGGG - Exonic
925013987 2:508010-508032 CCCTGGAGTCAAGGAGGCCACGG + Intergenic
925262605 2:2541613-2541635 TCCCAGAACCAGGCAGTCCAGGG + Intergenic
925270723 2:2605408-2605430 CACAGGAGCCAGGCAGCCGACGG - Intergenic
925357679 2:3253635-3253657 CTCCAGAGCCAGGCAGCCTATGG - Intronic
925836019 2:7947709-7947731 CCCTGGAGTCACACAGGCCAGGG + Intergenic
925872608 2:8284171-8284193 CCCCTGAGACATGCAGGCCGGGG - Intergenic
926113412 2:10196614-10196636 CCCCGGAGCCCGGCCCCCCATGG - Intronic
926707011 2:15844139-15844161 CTCAAGTGCCAGGCAGGCCAAGG + Intergenic
926724226 2:15984742-15984764 GCCCAGAGACTGGCAGGCCAGGG - Intergenic
927472106 2:23384904-23384926 CCGCGGAGCCAGGCGAGCCGGGG + Intergenic
927784162 2:25960981-25961003 CTTTGGAGCCAGGCAGGCCTAGG - Intronic
928244399 2:29614730-29614752 AACAGGAGCCATGCAGGCCAGGG - Intronic
930077437 2:47418347-47418369 CCCTGGAGCCATGCAAGACAGGG - Intronic
930108230 2:47656687-47656709 CCCAGGAGCAAGGCAGAGCATGG - Intergenic
930525984 2:52530172-52530194 CACCTGAGCCAGGGAGGTCAAGG - Intergenic
931721765 2:65072074-65072096 CCCCGGAGTCCTGCAGGACAGGG - Exonic
932448455 2:71794801-71794823 CCATGGAGCCAGGCAGGCCTGGG + Intergenic
933870782 2:86563388-86563410 CCCCGCGCCCAGGCAGGTCACGG + Intronic
934636309 2:95992429-95992451 CCCCGGGGCCAGCCTGGCCGCGG - Intergenic
934797334 2:97112997-97113019 CCCCGGGGCCAGCCTGGCCGCGG + Intergenic
934836071 2:97590442-97590464 CCCCGGGGCCAGCCTGGCCGCGG - Intergenic
934928213 2:98396943-98396965 CCCCGAAGCCAAGAAGGCCCTGG + Exonic
935406895 2:102718825-102718847 CCCCAGGGCAAGGCCGGCCACGG + Exonic
937047208 2:118858247-118858269 CTTCAGAGCCAGGCAGCCCAGGG - Intergenic
937236491 2:120434528-120434550 CCCGGGAGCCAGCCAGGGCCAGG + Intergenic
937357735 2:121208926-121208948 CCCTGGAGCCCAGCAGCCCACGG + Intergenic
937379904 2:121367250-121367272 CCCAGGGCCCAGGTAGGCCAGGG - Intronic
938080292 2:128366547-128366569 CCCCTGAGCGAGGCAGTGCAGGG + Intergenic
938198379 2:129352825-129352847 CCCAGGAGGCAGCCAAGCCAAGG + Intergenic
940300704 2:152174073-152174095 CTCGGGAGCCAGGCAGGGAAAGG + Intronic
940316181 2:152329907-152329929 CACTGGAGCCCGGGAGGCCAAGG + Intergenic
942098551 2:172556182-172556204 CCCCGGGCCCGGGCCGGCCAAGG - Exonic
944618505 2:201486961-201486983 CACCTGAGCCTGGGAGGCCAAGG - Intergenic
945067659 2:205960743-205960765 GCCAGGAGCCTGGGAGGCCAGGG + Intergenic
945471309 2:210230453-210230475 CCCTGGGGCCAGGAAGGCCTTGG - Intergenic
946449736 2:219769485-219769507 TCCCGGAGGCAGGCAGGCCTCGG + Intergenic
947745922 2:232507251-232507273 TCCCGGAGCCAGGACTGCCATGG + Intergenic
948462083 2:238134605-238134627 CCCCGGGGGCAGGCAGGCACTGG + Intergenic
948549875 2:238764176-238764198 CCCTCGAGCCAGGGAGGTCAAGG - Intergenic
948808442 2:240462945-240462967 CCCCAGAGCCTCGCAGGCCAGGG + Intronic
1169079607 20:2788520-2788542 CCCAGCAGCGAGGGAGGCCAAGG - Intergenic
1169211337 20:3767676-3767698 CCCCGGGGCCGGGGAGGGCAGGG + Exonic
1170904627 20:20502560-20502582 CTCCGGTGACAGGCAGACCAGGG - Intronic
1172113746 20:32562073-32562095 GCCTGGAGCCAGGCACCCCATGG - Intronic
1172271581 20:33658414-33658436 CCCTGGAGTGAGTCAGGCCAGGG - Intronic
1172367558 20:34361664-34361686 CCCAGGAGTTAGGGAGGCCAAGG - Intergenic
1172388491 20:34550128-34550150 CCCGTGTGCCAGGCCGGCCAAGG + Intronic
1172393661 20:34583752-34583774 TTCCGGAGCCTGCCAGGCCATGG + Intronic
1172750209 20:37245472-37245494 CCCCTGAGGAAGGCAGGGCAGGG - Intergenic
1172882969 20:38213556-38213578 TCCCTGAGCCGGGCAGGCCTGGG - Exonic
1173928442 20:46798466-46798488 CCCTGGAACCAGGCAGTACAGGG - Intergenic
1174385492 20:50186499-50186521 CCTCGGAGCCTGGCAGCCCTTGG + Intergenic
1175052547 20:56168567-56168589 GTCAGGAGCCAGGCAGCCCAGGG + Intergenic
1175123556 20:56735341-56735363 ACAAGGAGCCAGCCAGGCCATGG - Intergenic
1175133837 20:56808532-56808554 CCCGGGAGGCAGGCTGGCCCTGG - Intergenic
1175237434 20:57524748-57524770 CCTCAGAGCCAGGCAGGCTTTGG + Intronic
1175247303 20:57589829-57589851 GCCAGGAGCCCAGCAGGCCAGGG - Intergenic
1175440953 20:58990963-58990985 CCCGAGAGCCTGGCAGGCCCTGG - Exonic
1175443851 20:59007383-59007405 CCCCGGAGCCAGGGAGGGAGCGG - Intergenic
1175939308 20:62530639-62530661 CCCCAGACCCAGCCAGGCCACGG - Intergenic
1175961296 20:62637888-62637910 CTCAGGAGCCAGGCAGACCGAGG + Intergenic
1176605736 21:8828859-8828881 CCCCGGAGCCCAGGAGGTCACGG + Intergenic
1177821473 21:26035181-26035203 CTCCAGAGCCAGGGAGGTCAAGG + Intronic
1178365948 21:31988912-31988934 CACCTGAGCCAGGGAGGTCAAGG - Intronic
1178437868 21:32575513-32575535 TCCAGGTGCCAGGCAGCCCAGGG + Intergenic
1179481046 21:41678849-41678871 CTCTGGAGGCAGGCAGACCAGGG + Intergenic
1179567059 21:42255819-42255841 CCCAGGAGCCCGAGAGGCCACGG - Intronic
1179933270 21:44586097-44586119 CAGGAGAGCCAGGCAGGCCAGGG - Intronic
1180007555 21:45029961-45029983 CAGCGGAGGCAGGGAGGCCACGG - Intergenic
1180078506 21:45475405-45475427 GCCCCGAGCCCGGCAGGCCTGGG - Intronic
1180093991 21:45546271-45546293 CCGGGGCTCCAGGCAGGCCAGGG - Intergenic
1180117360 21:45719099-45719121 CCCCGAATTCAGCCAGGCCAGGG - Intronic
1180120922 21:45747583-45747605 CCCCAGAACCAGGAGGGCCAGGG + Intronic
1180348033 22:11720464-11720486 CCCCGGAGCCCAGGAGGTCACGG + Intergenic
1180839229 22:18951147-18951169 CCGTGGGGCCAGGGAGGCCAAGG - Intergenic
1180996880 22:19970263-19970285 CCCTGCAGGCAGGCAGACCACGG - Exonic
1181062661 22:20289309-20289331 CCGTGGGGCCAGGGAGGCCAAGG + Intergenic
1181455000 22:23054143-23054165 GTCAGGAGGCAGGCAGGCCATGG - Intergenic
1181488563 22:23247141-23247163 CCCAGGTCCTAGGCAGGCCATGG - Intronic
1181499280 22:23306671-23306693 CCCCGCAGTCTGGCTGGCCAAGG - Intronic
1181647710 22:24242795-24242817 CCCCCCAGCCAGTCCGGCCAGGG + Intronic
1182279204 22:29208358-29208380 CCCCGGAACCAGGGTGCCCAAGG + Intronic
1182297084 22:29315984-29316006 CCCCGGAGTCAGGCCGCCCGGGG + Intronic
1183099210 22:35573654-35573676 CCCCGGATTCAGGCACGCCGTGG + Intergenic
1183205762 22:36417975-36417997 CACCTGAGCCTGGGAGGCCAAGG - Intergenic
1183269169 22:36850027-36850049 CCAAGGAGACAGGAAGGCCAAGG + Intergenic
1183360489 22:37380618-37380640 TCCCTGAGCCAGGCTGGCCAAGG + Intronic
1183834968 22:40444815-40444837 CCCAGCACCCTGGCAGGCCAAGG + Intronic
1183903100 22:41021148-41021170 GCCAGGAGCCAGCCAGCCCAGGG - Intergenic
1184155173 22:42662500-42662522 CCGCGGAGCCCCGCAGCCCAAGG - Intergenic
1184249857 22:43253821-43253843 CTCCAGAGCCAGGCAGGACCAGG - Intronic
1184276720 22:43412934-43412956 CCCAGGAGTCTGGCAGGCCCCGG + Intronic
1184446072 22:44547646-44547668 CCTGGGAGCCAGGCAGGGCTGGG - Intergenic
1184552761 22:45213327-45213349 CCCAGGAGCCAGGCAGGGCATGG - Intronic
1184561195 22:45263806-45263828 TCCCAGAGCAAGGCTGGCCAGGG + Intergenic
1184696584 22:46142847-46142869 CCCTGAGCCCAGGCAGGCCAGGG - Intergenic
1184947460 22:47813689-47813711 CCCCGCAGCCAAGCAGCCCACGG - Intergenic
1185039010 22:48494982-48495004 CCCTGGAGCCAGGAGGACCAGGG - Intronic
1185203643 22:49523809-49523831 TCCTGGAGCCAGGCAGGTCCGGG + Intronic
1185314031 22:50171062-50171084 CCGCGGACGCAGCCAGGCCACGG - Intronic
1185353944 22:50354949-50354971 CTCAGGAGCCTGGCAGGTCAAGG - Intronic
1185363650 22:50424233-50424255 CCCCAGAGCCAGGCAGAAGACGG - Intronic
1203275655 22_KI270734v1_random:84138-84160 CCCCCAAGGCAGGAAGGCCAAGG + Intergenic
950125834 3:10509300-10509322 ACCCCGAGCCAGGCAAGGCAAGG - Intronic
950161492 3:10764294-10764316 CCCCCGGGCCAGCCAGGCCCGGG + Intergenic
950173708 3:10856788-10856810 CTCTGGAACCAGGCAGGCCCCGG + Intronic
950555541 3:13693644-13693666 CCCTGGAGGTTGGCAGGCCAGGG - Intergenic
953983049 3:47422256-47422278 CTTCTGAGCCAGGCATGCCAGGG + Intronic
954124429 3:48520356-48520378 TCCCTGAGCCCGACAGGCCAAGG - Intronic
954339207 3:49939771-49939793 GCCTCGAGCTAGGCAGGCCAGGG + Intergenic
954714106 3:52518623-52518645 CCCCAGAGCGAGGCTGGGCAGGG + Intronic
954735269 3:52702460-52702482 CCCCTGAGCCAGGGAGGTCAAGG + Intronic
954818905 3:53307480-53307502 CCCAAGAGCCAGGGAAGCCATGG - Intronic
955685795 3:61547510-61547532 CACCTGAGCCAGGGAGGTCAAGG - Intergenic
959849309 3:111070085-111070107 TCCCGGAGCGATGCAGGACAAGG + Intronic
961305809 3:125958735-125958757 CCCTGGAGGCAGGCAGCCCCCGG + Intergenic
961351646 3:126308062-126308084 CCCCCGTCCCAGCCAGGCCACGG - Intergenic
961656042 3:128442353-128442375 CCCCAGAGCAAGACAGGCCCCGG - Intergenic
961700604 3:128741903-128741925 CGCCTGAGCCTGGGAGGCCAAGG - Intronic
963046103 3:141103788-141103810 CTCAGGAGCCAGGCAGAGCAAGG + Intronic
964152944 3:153549941-153549963 CCCATGAGCCTGGGAGGCCAAGG - Intergenic
964792668 3:160467765-160467787 CACCTGAGCCAGGGAGGTCAAGG + Intronic
965582062 3:170279109-170279131 CACCTGAGCCAGGCAGGTCAAGG - Intronic
966769148 3:183488585-183488607 CCTCGGACTCAGGCAGGACATGG - Exonic
967978155 3:195046790-195046812 CCCAGGAGGCAGGGAGGCCTTGG - Intergenic
967983335 3:195078359-195078381 GCCCGTAGCGAGTCAGGCCATGG + Intronic
968481654 4:835682-835704 CCGCGGAGCCCTTCAGGCCACGG + Intergenic
968555100 4:1242846-1242868 CCCACGAGCCAGCCTGGCCAGGG + Intronic
968730888 4:2268715-2268737 CCCCTGCACAAGGCAGGCCAAGG + Intergenic
969131876 4:4996095-4996117 CCCCGAAGCCAGCCAGGCTGTGG - Intergenic
969206606 4:5651995-5652017 ACACGGAGCCTTGCAGGCCATGG + Intronic
969592681 4:8130857-8130879 CCCAGCAGCCAGGCAAGGCAAGG - Intronic
969720153 4:8889049-8889071 CCCCTGAGCGTGGCAGTCCAAGG - Intergenic
971374894 4:26048775-26048797 CCAGGGAGGCACGCAGGCCAGGG - Intergenic
972285233 4:37642011-37642033 CCCTGGAGTCAGACAGACCAGGG - Intronic
972446422 4:39148624-39148646 CACCTGAGCCTGGGAGGCCAAGG + Intergenic
972592149 4:40497905-40497927 CCTGGGAGCCTGGCAGGTCAAGG + Intronic
973330612 4:48907175-48907197 CCTGGGAGCCAAGCAGGCCTGGG - Intergenic
973372373 4:49262135-49262157 CCCCGGAGCCCAGGAGGTCACGG - Intergenic
973388627 4:49533003-49533025 CCCCGGAGCCCAGGAGGTCACGG + Intergenic
973765338 4:54157041-54157063 CACTTGAGCCAGGGAGGCCAAGG + Intronic
974329283 4:60455783-60455805 CCTCAGAGGGAGGCAGGCCAGGG - Intergenic
975387502 4:73774208-73774230 GCCCGTTGCCAGGCAGACCATGG - Intergenic
975521004 4:75300782-75300804 CCACTGAGCCAGGCAGGCGCGGG + Intergenic
978685351 4:111435756-111435778 ACACAGAGCCAGGCAGCCCATGG - Intergenic
978711902 4:111792856-111792878 CCCAAGAGCCAGGCAGTGCAGGG - Intergenic
980055509 4:128075629-128075651 CACCTGAGCCTGGAAGGCCAAGG - Intronic
981267563 4:142804748-142804770 CACCTGAGCCAGGGAGGTCAAGG - Intronic
981274165 4:142878061-142878083 CCCCTGAGCCAGGAAGGTTATGG + Intergenic
982257791 4:153466871-153466893 CCCCCGAGCCTGGCCGCCCAGGG + Intronic
984317145 4:178141914-178141936 GCCGGGAGGCAGGCATGCCATGG - Intergenic
985656700 5:1135506-1135528 CCCGGGATCCAGGGTGGCCATGG + Intergenic
986504041 5:8430419-8430441 CCATGGAGCCAGGCAAGCCATGG - Intergenic
986798896 5:11239732-11239754 CCACTGGGCCAGGCAGGCCAGGG - Intronic
987168668 5:15229040-15229062 CCCCTGAGCCTGGGAGGTCAAGG - Intergenic
987312056 5:16690556-16690578 CTCAGGACCCAGACAGGCCAGGG + Intronic
987816114 5:22902241-22902263 CCCCAGAGCCGAGCAGGCAAGGG - Intergenic
988264156 5:28928196-28928218 CCCCGGGGCCAGCCCGGCCGCGG - Intergenic
992037708 5:72797497-72797519 CACCTGAGCCAGGCAGGCCAAGG - Intergenic
992098476 5:73382789-73382811 CCCCAAAGCCAGGAAGCCCAGGG - Intergenic
995495505 5:112737942-112737964 CCCCGCAGCAAGCCTGGCCATGG - Intronic
996039281 5:118792546-118792568 CCCCAGAGACAGCCAGGCAAAGG + Intergenic
996065629 5:119075813-119075835 CCCAGCAGCCTGGGAGGCCAAGG - Intronic
996234262 5:121107467-121107489 TTCCGGAGCCAGGGAGCCCATGG - Intergenic
997368385 5:133340227-133340249 CCCTGGAGCCAGGCCAGGCAAGG - Intronic
997370996 5:133359870-133359892 CCGGGGAGCCAAGGAGGCCAGGG + Intronic
999173295 5:149613845-149613867 CCCCTGAGCCTGGGAGGTCAAGG - Intronic
999243554 5:150140965-150140987 CCCACGACACAGGCAGGCCAGGG + Intronic
999287235 5:150401497-150401519 CTGCGGGGCCAGGCAGGCCTGGG - Intergenic
1001288884 5:170442559-170442581 CCCCAGAGCCAGACAGGGCAGGG - Intronic
1001486018 5:172120171-172120193 CCTGGGAACCTGGCAGGCCAAGG - Intronic
1001560363 5:172665230-172665252 CCCCAGTGCCCAGCAGGCCAAGG - Intronic
1001633894 5:173196288-173196310 CCTCGGAGCCAGGGAGGCGCTGG + Intergenic
1002076800 5:176713129-176713151 CCCTGGAGACGGGAAGGCCATGG + Intergenic
1002087249 5:176783850-176783872 CCCCTGAGCCTGGGAAGCCAAGG + Intergenic
1002414547 5:179112818-179112840 CCCTGGAGCCAAGGTGGCCAGGG + Exonic
1002424426 5:179166966-179166988 CTCAGGAGCCAGGCTGGGCAGGG + Intronic
1002607238 5:180390565-180390587 CACGGGGGGCAGGCAGGCCAGGG - Intergenic
1002840369 6:900122-900144 CCCAGGACTCAGGGAGGCCAAGG - Intergenic
1004486753 6:16073415-16073437 CCCCAGAACCAGGGAGCCCAGGG - Intergenic
1004924512 6:20403790-20403812 CCCCGGAGCCAGGCTGGTTTCGG + Intronic
1005065598 6:21814763-21814785 CACTTGAACCAGGCAGGCCAAGG - Intergenic
1006424461 6:33955710-33955732 CCCCTCAGCCAGGAAGGCAAAGG + Intergenic
1006672507 6:35738194-35738216 CCCAGGGGCCAGGCCGGCTAGGG - Intronic
1006706309 6:36024392-36024414 CCGCAGAGCCAGGCACGCCGTGG - Intronic
1006734356 6:36262094-36262116 CCCTGCAGCCAGGCAGTGCAAGG + Intronic
1006787301 6:36677212-36677234 CTCCAGGGCGAGGCAGGCCAAGG + Intronic
1007336234 6:41157096-41157118 CCCCTGAGCCAGGGAGGCCATGG + Intergenic
1007388974 6:41538927-41538949 CCCTGGAGCCAGGCAGCTGAAGG - Intergenic
1007410214 6:41657136-41657158 CTCTGGAGCCATGGAGGCCATGG - Intergenic
1007483831 6:42167096-42167118 CCCCTGAGACAGGGATGCCAAGG - Intronic
1007735152 6:43977770-43977792 CCTCGAGGCCAGGCAGGGCAAGG - Intergenic
1011419537 6:87156242-87156264 GCCCGGAGACAGCCAGGACAGGG - Intronic
1012000782 6:93652002-93652024 CACCTGAGCCAGGCAGGCAGAGG - Intergenic
1012062892 6:94511144-94511166 CCCCTGAGCCAGGAAGGGGATGG + Intergenic
1014279597 6:119426734-119426756 CCTCAGACCCAGGCATGCCACGG - Intergenic
1016374312 6:143404797-143404819 TCCAGGAGCTGGGCAGGCCATGG + Intergenic
1016385017 6:143522470-143522492 CCCCAGAGGCAGGCAGGGCTGGG - Intergenic
1017520090 6:155194410-155194432 CCCCGGTGCCAGCCAGGGAAGGG + Intronic
1017920355 6:158867267-158867289 CCTTGGAGCCAGGCAGGCTTGGG - Intergenic
1018008372 6:159644974-159644996 CACCTGAGCCAGGGAGGTCAAGG + Intergenic
1018714509 6:166521325-166521347 CCCCGGAGCTTTGCAGGGCAGGG - Intronic
1018716650 6:166538227-166538249 CACAGGAGCCAGGAAGGCTAGGG - Intronic
1018795150 6:167179779-167179801 TCCAGGTGCCAGGCAGCCCAGGG - Intronic
1018821168 6:167375283-167375305 TCCAGGTGCCAGGCAGCCCAGGG + Intronic
1018945834 6:168346153-168346175 CCCCAGAGCCAGGCCGGAGAGGG + Intergenic
1019187058 6:170226847-170226869 CCTCTGTGCCAGGCAGACCAGGG + Intergenic
1019198787 6:170297146-170297168 CCCTGCAGCCAGACAGGCCCAGG - Intronic
1019209714 6:170395167-170395189 CCCTGGACCCATGCAGGCCATGG - Intronic
1019392284 7:795107-795129 ACCTGGACCCAGGCAGGGCAGGG + Intergenic
1019432185 7:1004221-1004243 CACCCGGGCCAGCCAGGCCATGG + Intronic
1019518160 7:1448580-1448602 CCGCCGAGCCAGGCAGGACCAGG - Intronic
1019523414 7:1470437-1470459 CCCTGAGGCCAGGCAGGCCCAGG - Exonic
1019563010 7:1667252-1667274 CCCCGGGGCCAGGCTGCCCAGGG + Intergenic
1019909343 7:4089658-4089680 CCCAGGAGTCAGGCAGCCCCAGG - Intronic
1020018123 7:4843560-4843582 GCCCAGAGTCAGGCTGGCCATGG - Intronic
1020195838 7:6038349-6038371 CGCTTGAGCCAGGGAGGCCAAGG + Intronic
1022524603 7:31028956-31028978 CGCCGGAGCCAGGGGGGCCTGGG + Intergenic
1023108667 7:36788620-36788642 CGCCTGAGCCCGGCAGGTCAAGG - Intergenic
1023652547 7:42387236-42387258 CCCCAGGCCAAGGCAGGCCAAGG - Intergenic
1023781553 7:43660614-43660636 CCCTGGAGTCAGGCAGACCTGGG - Intronic
1023991839 7:45133213-45133235 GGCTGGAGCCAGGCAAGCCAGGG - Intergenic
1024205257 7:47153768-47153790 CCTTGGAGCCAGGCAGACCTGGG + Intergenic
1026518076 7:71089955-71089977 CACCTGAGCCAGGGAGGTCAAGG + Intergenic
1026784077 7:73289977-73289999 CCCAGCACCCAGGGAGGCCAAGG - Intergenic
1026841531 7:73671916-73671938 CCCTGGGGCAAGGTAGGCCAGGG + Exonic
1026972734 7:74477952-74477974 CCCTGGGGCCAGGCAGTGCAGGG - Intronic
1027385818 7:77658882-77658904 CACCTGAGCCAGGGAGGTCAAGG + Intergenic
1028641144 7:93043508-93043530 CGCCGGAGCCGGAGAGGCCAGGG + Intergenic
1029277428 7:99415305-99415327 CCTTGGTGCCAGGCAGGCAAGGG - Intronic
1029324514 7:99794556-99794578 CCCAGGAGCCTGGCTGGGCACGG - Intergenic
1029363021 7:100100843-100100865 CCCCGGGGGCGGGCAGGCCGGGG - Intronic
1029459588 7:100687254-100687276 GCGCAGAGCCGGGCAGGCCAGGG - Intronic
1031026020 7:116680856-116680878 CACCTGAGCCTGGGAGGCCAAGG + Intronic
1031979926 7:128117963-128117985 GACCAGAGCCAGGCAGGCAAAGG + Intergenic
1034563506 7:151896262-151896284 CCCTGAAGCCAGGCAGGTCCTGG + Intergenic
1034829933 7:154300196-154300218 CCCTGGAGCCTGGCGGGGCATGG - Intronic
1034965910 7:155390734-155390756 CACCTGAGCCTGGCAGGTCAAGG + Intronic
1035281442 7:157780945-157780967 CCCCTGAGCCAGGCAGCTCCAGG + Intronic
1035562141 8:613829-613851 CCCAGGAGCCAGCCAGGGCCTGG - Intergenic
1035817515 8:2557369-2557391 CCCAGGAGGCAGGGAGGCCGTGG - Intergenic
1037662454 8:20939530-20939552 AGCAGGTGCCAGGCAGGCCAGGG + Intergenic
1037816790 8:22116762-22116784 CCCAAGAGCCGGGCAGGGCAGGG - Intronic
1037817349 8:22119172-22119194 GCCCGGTGCCAGGCAGGCAGTGG + Exonic
1037923757 8:22828812-22828834 CCCAGGAACCAGAGAGGCCATGG - Intronic
1040987741 8:53314871-53314893 CTCTGCAGCCAGGCAGGCCAGGG + Intergenic
1041207214 8:55511216-55511238 CCCCTGAACCCCGCAGGCCAAGG + Intronic
1041721858 8:60983442-60983464 CCCAGCAGCCAGGGAGGGCAAGG + Intergenic
1041819366 8:62012309-62012331 CACCTGAGCCAGGGAGGTCAAGG + Intergenic
1042533287 8:69835153-69835175 CCCCGCAGCCACGCAGGTGAAGG - Intergenic
1043942406 8:86210600-86210622 CACCTGAGCCTGGGAGGCCAAGG + Intergenic
1044115305 8:88327718-88327740 CCCGAGAGCCAGGCAGACCCCGG - Intronic
1045414030 8:101948771-101948793 ACCCGGAGCCAGGCTGCCTATGG + Intronic
1046625511 8:116572681-116572703 CCCCAGTGCCAGGAGGGCCACGG - Intergenic
1047499487 8:125430650-125430672 CCCCGGACCCCCGCAGGCAAGGG - Exonic
1048303349 8:133267086-133267108 CCCCGAAGCCAGCCAGCCCCAGG + Intronic
1048968188 8:139629002-139629024 AGTCGGAGCCAGGCTGGCCAAGG - Intronic
1049203343 8:141352186-141352208 CCCTGGAGTCAGGCAGGGCTGGG + Intergenic
1049278519 8:141732070-141732092 CCCCGAGGCCCTGCAGGCCACGG - Intergenic
1049503999 8:142985225-142985247 CTCCCTTGCCAGGCAGGCCATGG - Intergenic
1049544826 8:143225753-143225775 CCCCGCAGCCCAGCAGGCCTTGG + Intergenic
1049607963 8:143538487-143538509 CTCAGGACCCAGGCAGGCCCGGG - Exonic
1049651484 8:143771796-143771818 CACCGGAGCCAGGTAGGCCTGGG - Intergenic
1049721207 8:144116306-144116328 CCCCAGAGCCAGGCGGGCTGAGG - Exonic
1049804769 8:144533889-144533911 CTCAGGAGCAAGGCAGGCAACGG - Intronic
1051692645 9:19732723-19732745 GCCCTGAGACAGGCAGGCCTGGG - Intronic
1051983792 9:23057592-23057614 CCCTGGAGTCTGGCAGTCCAGGG - Intergenic
1052851532 9:33381319-33381341 CCCTGGAGGCAGGGCGGCCATGG - Intergenic
1052968834 9:34363927-34363949 CCCTGGAGCCATGCAACCCAGGG + Intergenic
1053523386 9:38804752-38804774 CCCCAGGGCCAGGCAGCCAAAGG - Intergenic
1054195615 9:62029171-62029193 CCCCAGGGCCAGGCAGCCAAAGG - Intergenic
1054352519 9:64029967-64029989 CCCCGGAGCCCAGGAGGTCAAGG + Intergenic
1054642792 9:67559518-67559540 CCCCAGGGCCAGGCAGCCAAAGG + Intergenic
1054767081 9:69051179-69051201 CACCCGAGCCAGGGAGGTCAAGG - Intronic
1055024307 9:71703136-71703158 CCACGGAGCCAGGCAAGAGATGG + Intronic
1055199982 9:73647849-73647871 CCCCGCACCCTGGGAGGCCAAGG - Intergenic
1055764705 9:79649997-79650019 CACCTGAGCCAGGGAGGTCATGG - Intronic
1056469113 9:86887485-86887507 CCCTGGGGCCAGGCAGTCAAAGG + Intergenic
1056487907 9:87077354-87077376 ACCTGGAAACAGGCAGGCCAGGG - Intergenic
1056580135 9:87884244-87884266 CCCCATATCCAGGCAGGCCTTGG - Intronic
1057211868 9:93204883-93204905 ACCCAGGGCCAGGCAGGACAGGG - Intronic
1059295795 9:113269136-113269158 CACCTGAGCCTGGCAGGTCAAGG + Intronic
1059449011 9:114358234-114358256 CCTGGGAGCCAAGCAGCCCAGGG + Intronic
1059679490 9:116572295-116572317 CCAAGGATCCAGGCAGGCCCTGG - Intronic
1060010045 9:120035956-120035978 CCACTGTGCCAGGCAGGCCAGGG - Intergenic
1060219023 9:121754733-121754755 CCCAGGAGCCCAGCAGGCCCAGG - Intronic
1060406119 9:123373885-123373907 CCCCGAAGCCAGGCGGGCAGCGG - Exonic
1060431108 9:123552183-123552205 TTACAGAGCCAGGCAGGCCACGG + Intronic
1060514774 9:124258661-124258683 CCCCCGAGCCAGGGAGCCCGTGG + Intronic
1060666820 9:125436699-125436721 CCCAGGGGCCAGCAAGGCCAGGG + Intergenic
1060965125 9:127707919-127707941 TCGTGGTGCCAGGCAGGCCATGG + Intronic
1061046131 9:128166157-128166179 ATCTGGACCCAGGCAGGCCAGGG + Exonic
1061471919 9:130834022-130834044 CCTTGGAGCCAGGCAGACCTGGG + Intronic
1061587850 9:131579945-131579967 CCTCAGAGTCAGGCAGGCCAGGG + Intronic
1061609895 9:131739581-131739603 CCCCCGCGCCCGGCAGGCAATGG + Intronic
1061769586 9:132908001-132908023 CACCTGAGCCAGGGAGGTCAAGG + Intronic
1061862407 9:133474899-133474921 CCCTGGAGGCTGGCAGGGCAGGG - Intronic
1061886733 9:133594864-133594886 GCCCAGAGGCAGGCAGGGCAAGG + Intergenic
1062026755 9:134344145-134344167 CCCAGGAACCTGGCAGGCCAGGG + Intronic
1062155842 9:135048028-135048050 CCCCTGAGCCTGGGAGGTCAAGG - Intergenic
1062625021 9:137438705-137438727 CCCAGGAGCCACGCCTGCCAGGG + Intronic
1203553130 Un_KI270743v1:180861-180883 CCCCGGAGCCCAGGAGGTCACGG + Intergenic
1203564458 Un_KI270744v1:79938-79960 CCACGGGGCCAGAGAGGCCAGGG + Intergenic
1185504028 X:619166-619188 CCCCGGGGCGAGGCAGGGGAGGG - Intergenic
1187126663 X:16460818-16460840 CTTTGGAGCCAGGCAAGCCAGGG - Intergenic
1188289452 X:28369692-28369714 CACCTGAGCCAGGGAGGTCAAGG - Intergenic
1189242578 X:39537189-39537211 TCCCGGAGCCAGGCAGACCCAGG - Intergenic
1189286817 X:39857746-39857768 CGTCGGGGCCAGGCAGGCCCAGG + Intergenic
1189806416 X:44739783-44739805 CTCTTGAGCCAGGGAGGCCAAGG + Intergenic
1189914862 X:45847135-45847157 CCCTTGAGCCTGGCAGGTCAAGG - Intergenic
1192240466 X:69324013-69324035 GCCTGGAGCCAGGCAGTCCGTGG - Intergenic
1193122362 X:77836810-77836832 CACCTGAGCCAGGGAGGTCAAGG + Intronic
1193133590 X:77945259-77945281 CACCTGAGCCAGGCAGGCAGTGG - Intronic
1194663408 X:96651112-96651134 CCCCTGAGCCCAGGAGGCCAAGG - Intergenic
1195299590 X:103514431-103514453 CACCTGAGCCAGGGAGGTCAAGG - Intronic
1196167478 X:112551557-112551579 CCCCCGAGCCAGGCACGGGAGGG + Intergenic
1197219841 X:123901299-123901321 CACCTGAGCCAGGGAGGTCAAGG + Intronic
1197712173 X:129679151-129679173 CCAAGGAGCCAGGCAGGAGAGGG - Intergenic
1198343390 X:135736504-135736526 CGCCTGAGCCTGGGAGGCCAAGG - Intergenic
1198750332 X:139932262-139932284 CCCCCGGGTCAGGCAGGCCGGGG - Intronic
1199031172 X:143002301-143002323 CCCAGGAGATAGGCAGGCAAAGG - Intergenic
1200093692 X:153647536-153647558 CCCCAGGGCCAGGTGGGCCAGGG - Intronic
1200134599 X:153868774-153868796 CCAGGGAGCCAGGGAGGGCAGGG - Intronic
1201158978 Y:11154557-11154579 CCACGGGGCCAGAGAGGCCAGGG - Intergenic
1201285320 Y:12374297-12374319 CTCCTGAGCCAGGAAGACCACGG - Intergenic