ID: 1077178218

View in Genome Browser
Species Human (GRCh38)
Location 11:1200115-1200137
Sequence TGAGATGGCAAGGGTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 729
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 665}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077178204_1077178218 17 Left 1077178204 11:1200075-1200097 CCAGGCAAAGGGCTCTGAGGGTG 0: 1
1: 0
2: 2
3: 25
4: 263
Right 1077178218 11:1200115-1200137 TGAGATGGCAAGGGTGGGGCTGG 0: 1
1: 0
2: 4
3: 59
4: 665
1077178201_1077178218 27 Left 1077178201 11:1200065-1200087 CCATGAGGGGCCAGGCAAAGGGC 0: 1
1: 0
2: 2
3: 16
4: 280
Right 1077178218 11:1200115-1200137 TGAGATGGCAAGGGTGGGGCTGG 0: 1
1: 0
2: 4
3: 59
4: 665

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077178218 Original CRISPR TGAGATGGCAAGGGTGGGGC TGG Intronic
900182626 1:1319004-1319026 TGAAATGGCCAGAGTGGGACAGG - Intronic
900340498 1:2186493-2186515 TGAGCTGGCCGGGGGGGGGCGGG - Intronic
900569095 1:3349596-3349618 TGTGCTGGCAAGGGTGGCGGAGG + Intronic
900582632 1:3416628-3416650 AGGGAGGGCAAGGGTGAGGCAGG - Intronic
900623729 1:3598841-3598863 TGAGAAGGAAGGGGTGGGGGAGG - Intronic
900679277 1:3907427-3907449 TGGGAAGGCAGGGGTGTGGCGGG + Intergenic
900687693 1:3959096-3959118 ACAGATGGCAGGGGAGGGGCAGG + Intergenic
900953058 1:5869403-5869425 TGAGAAGGAGAGAGTGGGGCAGG + Intronic
901111571 1:6800910-6800932 TGAGATGGAAAGGATAAGGCAGG - Intronic
901653595 1:10756591-10756613 TGTGAGGGCCAGGTTGGGGCAGG - Intronic
902619471 1:17642535-17642557 GGAGAGGGCATGGGAGGGGCAGG + Intronic
902675123 1:18003345-18003367 TGAGCTGGAAAGGTTGGGGCGGG + Intergenic
903298121 1:22358884-22358906 TGTGATGGCCCTGGTGGGGCAGG + Intergenic
903354384 1:22737216-22737238 TGAGATGGTCCAGGTGGGGCAGG - Intronic
903365720 1:22804598-22804620 TGAGCAGGGCAGGGTGGGGCGGG - Intronic
903384633 1:22918345-22918367 AGAGGTGGCAGGGGTGGGGTGGG + Intergenic
903475964 1:23619425-23619447 TCAGAAGTCAAGGGTGGAGCTGG + Intronic
903776158 1:25795156-25795178 TAAGATGGCAGGGATTGGGCAGG - Intergenic
903778116 1:25806086-25806108 TGAGATGAAAAGGCTGGGTCGGG - Intronic
904154744 1:28473598-28473620 TTAGGTGGTAAGGGTGGGGACGG - Exonic
904295277 1:29516265-29516287 TGGAATGGCAGGCGTGGGGCTGG + Intergenic
904335030 1:29791420-29791442 TGGAATGGCAGGTGTGGGGCTGG + Intergenic
904747509 1:32720186-32720208 TGACATGACAAGGATGTGGCTGG + Intergenic
904771811 1:32885137-32885159 AGAGATGGCCGGGGTGGGTCTGG - Intergenic
904904364 1:33883923-33883945 TGAGCTGGGCAGGGCGGGGCTGG + Intronic
905318858 1:37101467-37101489 AGAAGTGGCATGGGTGGGGCAGG + Intergenic
905899717 1:41573450-41573472 TGAGATAGCCAGGCTGGGGGAGG + Intronic
905918199 1:41700302-41700324 TGAGAGGGCAGGCATGGGGCTGG + Intronic
905927762 1:41764096-41764118 TGAGATGGGAAGGGTGGGTTGGG + Intronic
906149288 1:43578221-43578243 GGAGCTGGAATGGGTGGGGCTGG + Intronic
906199622 1:43951028-43951050 TGAGTTGGGAGGGGTGGGGCTGG + Intronic
906244270 1:44262189-44262211 TCAGTTGGTTAGGGTGGGGCTGG - Intronic
906297565 1:44658512-44658534 GGAGATTGGAGGGGTGGGGCAGG - Intronic
906525878 1:46493068-46493090 TGGGAAGGCAGGGGTGGGGGAGG - Intergenic
907158878 1:52357296-52357318 AGAGATGACAAGGCTGGGCCAGG - Intronic
907287997 1:53394335-53394357 TGAGATGGGAAGGATGAGGTTGG - Intergenic
907462877 1:54615680-54615702 GCAGAGGGGAAGGGTGGGGCTGG + Intronic
907978320 1:59455448-59455470 TGAGAAGGCAAGGGTGGGGATGG + Intronic
908242095 1:62196218-62196240 TGAGGAGGCCAGGGAGGGGCCGG - Intronic
908530213 1:65027008-65027030 TGAGATGGCCTGGGTAGAGCTGG + Intergenic
908562263 1:65318696-65318718 TGTCAGGGCATGGGTGGGGCGGG + Intronic
910634749 1:89394915-89394937 TGAGATGGGTATGGTGGGGTGGG - Intergenic
910716803 1:90240782-90240804 AGAGAGGGCAAGGCTGGGGCAGG + Intergenic
910768976 1:90811683-90811705 TGAAATGGCAATGATAGGGCTGG - Intergenic
912806010 1:112757780-112757802 TGTGATGGAGAGGGTAGGGCTGG + Intergenic
913115581 1:115693287-115693309 AGAGATGGCAAGTGTGAGACGGG + Exonic
914404220 1:147354819-147354841 TGAGATGGAAAGTGTGTGGTAGG - Intergenic
914876468 1:151516153-151516175 TGAGATGAGAAGGGAGGGGAAGG - Intronic
914996358 1:152546419-152546441 TGTGATGGGAAGGGCTGGGCTGG - Intronic
915475762 1:156151969-156151991 AGAGAAGGCAAGGGTGGGCTGGG - Intronic
915629682 1:157142619-157142641 TGGGAAGGCAGGGGTGGGGGTGG - Intergenic
916494781 1:165336636-165336658 TGAGATGGCAACGGTGTAGGTGG - Intronic
917621178 1:176797707-176797729 TGAGATGGACAGGGAAGGGCTGG - Intronic
917645803 1:177027525-177027547 CGAGATGGTAAGGATGAGGCTGG - Intronic
918107595 1:181427321-181427343 TGAGATGGGAGGGGTTGGGACGG - Intronic
918241733 1:182626244-182626266 TGAGCAGGGAAGGGTGGGGTGGG - Intergenic
919710642 1:200724278-200724300 TTAAATGGCAAGTGTTGGGCAGG - Intergenic
919972953 1:202592389-202592411 GGAGGAGGCAGGGGTGGGGCTGG + Exonic
920253156 1:204636053-204636075 TCATATGGCAAAGATGGGGCTGG - Intronic
920322528 1:205135451-205135473 AGAGATGGCGGGGGTGGGGGGGG - Intergenic
922784125 1:228274740-228274762 TGAGATGGTCAGGCTGTGGCTGG - Exonic
922803442 1:228374206-228374228 GGAGTTGGCAGTGGTGGGGCAGG + Intronic
922860173 1:228809833-228809855 AGAGAAGGAATGGGTGGGGCAGG - Intergenic
923517541 1:234710107-234710129 ACAGATGGCTGGGGTGGGGCTGG - Intergenic
923521930 1:234741582-234741604 TGAGATAGGAAGGCTGTGGCTGG + Intergenic
923744663 1:236688873-236688895 TGAAATGGCAAGTGTGGAGAAGG - Intronic
924211333 1:241770302-241770324 TGAAATGGCAAGGGGTGGGGTGG - Intronic
924424121 1:243934250-243934272 TGAGAGGGGAAGGGAGGGGAAGG - Intergenic
924564705 1:245187341-245187363 GGAGATTGCAAAGATGGGGCAGG + Intronic
1063116733 10:3076875-3076897 TGAACTGGCAGGGGTGGGGAGGG + Intronic
1063162894 10:3432385-3432407 GGAGAAGGCAAGGCTGGGACGGG - Intergenic
1067251119 10:44587775-44587797 TGCTATGGCAAGGCTGGGGAGGG + Intergenic
1069223395 10:65911202-65911224 TGAGAAGGCAAGAATGTGGCAGG + Intergenic
1069782090 10:70963248-70963270 TTGGATGGCAGGGGTGGGGAGGG + Intergenic
1070206037 10:74262433-74262455 TGAGAGGTAGAGGGTGGGGCAGG + Intronic
1071123716 10:82310224-82310246 TGCGATTGGAAGGATGGGGCAGG + Intronic
1071132920 10:82416695-82416717 TGAGATGGTCAGGGTGGGTGGGG - Intronic
1071471456 10:85987019-85987041 GGAGCTGGTTAGGGTGGGGCAGG - Intronic
1071531598 10:86393576-86393598 TGTGGCAGCAAGGGTGGGGCGGG + Intergenic
1071808957 10:89156943-89156965 TGAGATGAGAAGGGTGGAGGAGG + Intergenic
1073041691 10:100612229-100612251 TCAGAGGTCAAGGATGGGGCTGG + Intergenic
1073173436 10:101533481-101533503 AGGGATGGCAGGGGAGGGGCTGG - Intronic
1073584027 10:104691644-104691666 TAAGATGGTAAGGGAGGGACAGG - Intronic
1074594779 10:114852081-114852103 TGAAATGGCAGGGCTGGGGTGGG - Intronic
1075091445 10:119446134-119446156 TGAGCTGGGATGGGTGGGGCAGG - Intronic
1075667405 10:124240905-124240927 TGAGTTGACACGGGTGGGGACGG + Intergenic
1075734992 10:124659054-124659076 TGGGATGGCGATGGTGGGGATGG + Intronic
1075975666 10:126691859-126691881 GGGGCTGGGAAGGGTGGGGCAGG + Intergenic
1076136844 10:128051131-128051153 TGGGATGAGAAGGGTGGGGGAGG - Intronic
1076475899 10:130751266-130751288 TGAGAGGGCAGGCCTGGGGCAGG + Intergenic
1076494149 10:130885759-130885781 GCAGATGGCAATTGTGGGGCTGG - Intergenic
1076769023 10:132653018-132653040 TCAGATGCCAAGGGTGCGGGTGG - Intronic
1076813278 10:132899970-132899992 TCACATGGCAAGGGTGGGAGTGG + Intronic
1076855484 10:133113734-133113756 GGAGAGGGCAAGGATGGGGGTGG + Intronic
1076930799 10:133530472-133530494 TGAGATGAGGTGGGTGGGGCAGG - Intronic
1077093736 11:790747-790769 TCACATGGCCAGGGCGGGGCAGG + Exonic
1077152278 11:1077670-1077692 CGAGAGGGCATGGGTGGGGCAGG + Intergenic
1077178218 11:1200115-1200137 TGAGATGGCAAGGGTGGGGCTGG + Intronic
1077355737 11:2115896-2115918 TGAGCTGGCCAGGGTTGGGCAGG + Intergenic
1077382501 11:2250781-2250803 TGAGTTGGCAAGGGTCGGTGTGG + Intergenic
1078533666 11:12156448-12156470 AGAGGAGGCAAGGGTGGAGCAGG + Intronic
1078699799 11:13669109-13669131 AGAGGTGGCGAAGGTGGGGCGGG + Intronic
1079355961 11:19730489-19730511 TGAGGTGACAGGGCTGGGGCCGG + Intronic
1081876314 11:46410717-46410739 TAAGATGGCAAATGTGAGGCTGG + Intronic
1083277169 11:61603456-61603478 TGAGAGGGCAAGGGAGAGGCGGG - Intergenic
1084270281 11:68025846-68025868 TGTGATGGTACAGGTGGGGCAGG - Intronic
1084296526 11:68216018-68216040 TGAGAGGCCCAGGGTGGGCCAGG + Intergenic
1084447726 11:69213371-69213393 AGAGCTGCCAGGGGTGGGGCGGG + Intergenic
1084492459 11:69486282-69486304 TGAGATGGTCCGAGTGGGGCAGG - Intergenic
1084788068 11:71455235-71455257 TGAGAAGGCAAGGAAGGAGCAGG + Intronic
1084929142 11:72540250-72540272 TGAGTGGGCAAGGGAGGGGAAGG - Intergenic
1084960170 11:72712372-72712394 TGAGGAGGCAAGGAGGGGGCGGG + Intronic
1085199509 11:74693255-74693277 TGAGAGGGCCAGGGTGAGGCTGG - Intergenic
1085232935 11:74988745-74988767 TGAGTTGGCGAGGGTGGAGGTGG + Exonic
1085697157 11:78714780-78714802 TGAGTAGGAAAGGGAGGGGCGGG - Intronic
1086362077 11:86069406-86069428 TGTGCTGGCGGGGGTGGGGCGGG + Intronic
1089297964 11:117481142-117481164 TGGGATGGGAAGGGTGGGGCAGG + Intronic
1089455967 11:118625974-118625996 TGACATGACAAGGCTGGGGTGGG - Intronic
1089473022 11:118736044-118736066 TGGGAGGCCAAGGGTGGGGTGGG - Intergenic
1089534873 11:119154742-119154764 TGACCTGGCATGGGTGGGGTGGG + Intronic
1089613379 11:119681823-119681845 GGTGATGGGCAGGGTGGGGCAGG + Intronic
1089625212 11:119746824-119746846 TGAGAGGCCAAGGGTGGGGGGGG + Intergenic
1089660862 11:119984081-119984103 ACAGATGGCAAGGGTGGGTGGGG - Intergenic
1089731777 11:120523792-120523814 GGAGATGATCAGGGTGGGGCTGG + Intronic
1091221817 11:133934285-133934307 GGAGTTGGCCATGGTGGGGCAGG - Intronic
1091249023 11:134126108-134126130 TGGGAAGACAAGGGTGGGACAGG - Intronic
1091311494 11:134578163-134578185 TGGGAGGGCAATGGTGGGGATGG + Intergenic
1091546603 12:1505213-1505235 GGAGGTGGCAAGGTGGGGGCCGG - Intergenic
1091783317 12:3227639-3227661 TGAGAAGGGGAGGCTGGGGCCGG - Intronic
1092007168 12:5079393-5079415 TGGCAGGTCAAGGGTGGGGCCGG - Intergenic
1092103236 12:5902800-5902822 TGGGATGGGAAGGGAGGGGAGGG + Intronic
1092109486 12:5948827-5948849 TGAGATGGCAACGGTGGGCAGGG - Intergenic
1092886640 12:12930106-12930128 TGAGATGGTTGGGGTGGGGTTGG + Intergenic
1092914789 12:13179915-13179937 TGGGAAGGCAAGGCTGGGGGCGG + Intergenic
1094494241 12:30979507-30979529 TGCCAGGGCAGGGGTGGGGCTGG + Intronic
1095951099 12:47782438-47782460 TGATATGGCAGGAGTGGGGGTGG - Exonic
1096123910 12:49106038-49106060 TGAGGGGGCAGGGATGGGGCAGG - Intronic
1096179151 12:49541153-49541175 TGAGACTGCAAAGGTGAGGCAGG - Intronic
1096586059 12:52620700-52620722 TGAGAAGGCCAGGGAGGGGAGGG - Intergenic
1096860683 12:54525718-54525740 GGGGATGGGAAAGGTGGGGCTGG - Intronic
1096913354 12:55006317-55006339 TGCAAGGGCAAGGGTGGTGCTGG - Intergenic
1097343851 12:58469474-58469496 TGAGATTTCAATGGTGGGGTGGG - Intergenic
1098301135 12:69055240-69055262 TGAGGAGGCCGGGGTGGGGCAGG - Intergenic
1099773606 12:87096817-87096839 TGAGATGGATGGGGTGGGGGGGG - Intergenic
1100643759 12:96507958-96507980 AGAGATGGCAGTGGTGGCGCAGG - Intronic
1101762463 12:107670094-107670116 TGAGGTGGCAGGAGTGGGGACGG + Intergenic
1102083296 12:110115752-110115774 GAAGATGGCAACAGTGGGGCTGG - Intergenic
1102381092 12:112467457-112467479 AGTGGTGGCAAGGGTGGGGTGGG + Intronic
1102551488 12:113695180-113695202 AGAGATGGCCAGGGAGGGGGAGG - Intergenic
1102679295 12:114679860-114679882 TTAGATGGTGAGGGTGGGGGGGG - Intronic
1102787960 12:115619558-115619580 TGCAATGGCAAGGATGGGACAGG - Intergenic
1102877024 12:116456879-116456901 AGAGAAGGCATGGGTGGGGCTGG - Intergenic
1103933269 12:124461673-124461695 TGAGATGGCGGGTGTGGGGCGGG - Intronic
1104237733 12:126955591-126955613 TCAAATGGCAAGTGTGGAGCAGG - Intergenic
1104268657 12:127262287-127262309 TGAGATGCCATGGCTGGGGAAGG - Intergenic
1104387219 12:128361439-128361461 TGTGATGGCAAGGGTCAGGCAGG - Intronic
1104539678 12:129652245-129652267 TCAGCTGGCAACCGTGGGGCTGG + Intronic
1104820025 12:131671857-131671879 TGAGATTCCAGGGTTGGGGCAGG - Intergenic
1104952556 12:132448289-132448311 TGCGATGACAAGGCAGGGGCGGG - Intergenic
1106031624 13:26010325-26010347 TGGGATGGCCAGGGTGGTTCAGG + Intronic
1106150883 13:27100560-27100582 TGACATGTCAAGGTTGGTGCAGG - Intronic
1106603634 13:31208544-31208566 TGAGACGGGAAGGGAGGGCCTGG - Intronic
1106977633 13:35239846-35239868 AGTGATGTCAAGGCTGGGGCAGG + Intronic
1107032841 13:35870765-35870787 TGAGATTGAGAGGGTGGAGCAGG - Intronic
1107999166 13:45890588-45890610 GGGTAGGGCAAGGGTGGGGCAGG + Intergenic
1109171614 13:59105132-59105154 TGAGATGGGGAGAGTGGGGCAGG - Intergenic
1109322103 13:60823532-60823554 TGTGATGGAGGGGGTGGGGCTGG + Intergenic
1110392661 13:74993398-74993420 TGAAGTGGCAAGGGTGGGCAAGG + Intergenic
1110733421 13:78907923-78907945 AGAGATGGCCAGGGTAGGGAGGG + Intergenic
1110806290 13:79757859-79757881 TGAGTAGGCAAGAGAGGGGCTGG + Intergenic
1112973294 13:105287053-105287075 TGAGATGGGAGGGGTGAGGAGGG - Intergenic
1113469173 13:110532154-110532176 TGCCAGGGCAAGAGTGGGGCTGG + Intronic
1113784823 13:112996954-112996976 TGAGATAGCGAGGGCGGGACTGG - Intronic
1113902591 13:113805077-113805099 TGGGATGGACAGGATGGGGCTGG + Intronic
1113912378 13:113849098-113849120 GGTGTTGGCAAGGCTGGGGCGGG - Intronic
1114137884 14:19873522-19873544 TCAGATGGCTAGGGTCTGGCTGG + Intergenic
1114217662 14:20668952-20668974 TGAGATGGTAAGGGTTCGGATGG + Intergenic
1114237506 14:20835451-20835473 TGAGAGGGAAAGGTAGGGGCTGG + Intergenic
1114627422 14:24138562-24138584 TGAGGAGGCAAGGGCAGGGCAGG + Exonic
1114933633 14:27506676-27506698 GGTGCTGGCAAGGGTAGGGCTGG + Intergenic
1115215010 14:31005336-31005358 GGGGATGGCAAGGGAGGGGAGGG + Intronic
1115618928 14:35122002-35122024 TGAGCTGGTAGGGGTGGAGCAGG - Exonic
1117206586 14:53449844-53449866 TGAGAGGTCACGGCTGGGGCTGG + Intergenic
1117376315 14:55121349-55121371 AGAGTTGGGAAAGGTGGGGCAGG - Intergenic
1117619479 14:57569788-57569810 TGGGATGGCAGGGCTGTGGCTGG - Exonic
1117726657 14:58681451-58681473 TGAGAAGTCAAGAGTGGTGCTGG + Intergenic
1117761596 14:59034824-59034846 GGAGATGGGAGGCGTGGGGCTGG - Intergenic
1118667739 14:68088668-68088690 TGAGATGGAAAGAGTGGCGGGGG + Intronic
1119159507 14:72441438-72441460 TTAGAAGGAAAGAGTGGGGCAGG + Intronic
1119266645 14:73266660-73266682 TCAGGTGGCATGGGTAGGGCAGG + Intronic
1119445620 14:74661087-74661109 TGAAAGGGCAAGAGTGGGACAGG + Intronic
1119675547 14:76550835-76550857 TGAGCTCACCAGGGTGGGGCTGG + Intergenic
1119720252 14:76885254-76885276 GGAGAAGGCAGAGGTGGGGCTGG - Intergenic
1119765521 14:77185218-77185240 TGAGATGGGAAGAGCTGGGCTGG + Intronic
1120387271 14:83862450-83862472 TGAGAGTGGAAGGGTGTGGCAGG + Intergenic
1120902263 14:89585903-89585925 AGAGATTGCAGGGTTGGGGCAGG + Intronic
1121267730 14:92615323-92615345 GGAGGTGGCAAGGATGGGGTCGG - Intronic
1121612109 14:95288381-95288403 TGAGAAGGCAGGGCTGGGGAAGG + Intronic
1121956933 14:98222885-98222907 AGGGATGGGAAGGATGGGGCTGG - Intergenic
1122263093 14:100534300-100534322 GGAGAGGGCAGGGGTGGAGCAGG + Intergenic
1122310708 14:100792363-100792385 GGAGAGGGGCAGGGTGGGGCCGG - Intergenic
1122694273 14:103545247-103545269 AGAGATGGCACGGAGGGGGCCGG + Intergenic
1122940183 14:104977703-104977725 TGAGAGGGCAAGCCTGGTGCAGG + Intronic
1122980824 14:105191719-105191741 TGGGATGGGGCGGGTGGGGCTGG + Intergenic
1124153830 15:27208124-27208146 TGAGATGGCAAAGCTGAGCCAGG + Intronic
1125004171 15:34799399-34799421 TGGGATGGCAGAGCTGGGGCGGG + Intergenic
1125284073 15:38073288-38073310 CGAGGGGGCAAGGGTGGGGGAGG - Intergenic
1125509916 15:40287282-40287304 TGGGATGGCAGGGTGGGGGCAGG + Intronic
1125514026 15:40307994-40308016 TGAGAGGCACAGGGTGGGGCTGG - Intergenic
1125519725 15:40341003-40341025 TGAGAGTGGAAGGGTGGGGGTGG - Intergenic
1125719231 15:41837201-41837223 TGACCTGGCCAGGGAGGGGCTGG - Exonic
1125724442 15:41861158-41861180 TGAGGTGGCAAGAATGGGTCAGG + Intronic
1126143258 15:45454656-45454678 TGAGATCGGAGGGGAGGGGCAGG + Intergenic
1126681140 15:51203140-51203162 CAAGATGGCAAGCTTGGGGCTGG + Intergenic
1128001555 15:64197443-64197465 AGAGATGGCAAAGTTGGGGGAGG - Intronic
1128347837 15:66865813-66865835 GGAGATGTGAGGGGTGGGGCTGG - Intergenic
1128767622 15:70260813-70260835 CGAGATGGCAAGGGTGAGGCAGG + Intergenic
1129382182 15:75174897-75174919 TGAAATGGCCACGGTGGGCCGGG + Intergenic
1129440915 15:75580031-75580053 AGAGAAGGCAAGGCTGGGTCTGG + Intergenic
1129670693 15:77606194-77606216 TGGGGTGGCCAGGGTGGGGCAGG + Intergenic
1129727648 15:77909680-77909702 TGGGAGGGCCAGGGTGGGGAGGG - Intergenic
1129745596 15:78017837-78017859 TCTGATGGCAAAGGTGGGTCAGG - Exonic
1129767361 15:78178828-78178850 TGAGCTGGCGAGGGAGGGGCCGG + Exonic
1129870485 15:78937056-78937078 TCAGATGGCAGGAATGGGGCAGG + Intronic
1130087594 15:80791163-80791185 TGAGATCATAAAGGTGGGGCAGG + Intronic
1130155453 15:81346318-81346340 AGAGAGGGCAGAGGTGGGGCAGG + Intronic
1130273511 15:82464638-82464660 TGAGAAGGCCAGGGTGTTGCGGG - Intergenic
1130465864 15:84192009-84192031 TGAGAAGGCCAGGGTGTTGCAGG - Intergenic
1130486837 15:84402816-84402838 TGAGAAGGCCAGGGTGTTGCGGG + Intergenic
1130498401 15:84481527-84481549 TGAGAAGGCCAGGGTGTTGCAGG + Intergenic
1130588151 15:85196605-85196627 TGAGAAGGCCAGGGTGTTGCGGG - Intergenic
1130652894 15:85772383-85772405 TGGCAGGGCCAGGGTGGGGCAGG - Intronic
1130727323 15:86452764-86452786 AGAAATAGCAAGGGTGGGTCAGG - Intronic
1131282193 15:91031096-91031118 GGAGAAGGCAAGGGTGGGGAGGG - Intergenic
1131373466 15:91903930-91903952 GGAGAGGGCAGGGGTGGAGCCGG + Intronic
1132431670 15:101766254-101766276 TGGGAGGGCAGGGGTGGGGAGGG - Intergenic
1132610193 16:812027-812049 TGAGCTGGCAGGGCTGGGGGTGG + Intronic
1132634803 16:938438-938460 GGGGATGGCAGGGGTGGGGCTGG + Intronic
1132847149 16:2005873-2005895 TGGGACGGCACTGGTGGGGCTGG + Intronic
1133196456 16:4174232-4174254 TGAGAGGCCGAGGGTGGGGGGGG + Intergenic
1133390192 16:5403976-5403998 GGCCATGGGAAGGGTGGGGCTGG + Intergenic
1133738433 16:8633075-8633097 GGAGATGGCATGGGTGGGACTGG + Intronic
1133975273 16:10596023-10596045 TCAGAGGGAAAGGCTGGGGCGGG + Intergenic
1133982344 16:10642445-10642467 TGGGAAGGACAGGGTGGGGCAGG - Intronic
1134082403 16:11334117-11334139 TGTCATGGCCATGGTGGGGCTGG - Intronic
1134537687 16:15039802-15039824 TGAGACAGCAAGTGTGGGGAGGG + Intronic
1134815496 16:17202256-17202278 TGAGATGGAGACTGTGGGGCTGG + Intronic
1134830016 16:17315361-17315383 TGAGATGCAAAGGATGAGGCTGG - Intronic
1136142934 16:28298813-28298835 AGACAGGGCACGGGTGGGGCTGG + Intronic
1136563649 16:31056449-31056471 TGGGAGGCCGAGGGTGGGGCGGG - Intergenic
1136682401 16:31975981-31976003 AGCGAGGGAAAGGGTGGGGCTGG - Intergenic
1136782659 16:32917149-32917171 AGTGAGGGAAAGGGTGGGGCTGG - Intergenic
1136887135 16:33936701-33936723 AGCGAGGGAAAGGGTGGGGCTGG + Intergenic
1137023338 16:35451634-35451656 TGGGGTGGCGAGGTTGGGGCTGG - Intergenic
1137023356 16:35451711-35451733 TGGGGTGGCGAGGTTGGGGCTGG - Intergenic
1137685182 16:50381822-50381844 TGGGATGGGGAGGGTGGGGAGGG + Intergenic
1138223146 16:55270146-55270168 TAAGATCCCCAGGGTGGGGCAGG + Intergenic
1138272283 16:55703852-55703874 TGAGGGGACCAGGGTGGGGCAGG + Intronic
1138862332 16:60773683-60773705 TGAGATGGCAAGGATGAAGAAGG + Intergenic
1139466378 16:67156139-67156161 TGAGATGGGAAAGGGGGGCCTGG + Intronic
1139531195 16:67543505-67543527 TGAGAGGGAAAAGGTGAGGCAGG + Intronic
1139551820 16:67677655-67677677 TGAGAAGGCAGGGGTGGGTTAGG + Intronic
1139566509 16:67780679-67780701 GAAGATGACAAGGGTGGGACAGG + Intronic
1139822313 16:69730246-69730268 AGAGATGGCAGAGGTGGGGGGGG - Intergenic
1140017132 16:71198510-71198532 TGAGATGGAAAGGGAATGGCTGG + Intronic
1140137565 16:72221024-72221046 AGAGAGAGCAAGGGTGGGGAAGG + Intergenic
1140998855 16:80288973-80288995 TGATAACGTAAGGGTGGGGCGGG + Intergenic
1141472888 16:84251622-84251644 TGAGGTGTATAGGGTGGGGCAGG + Intergenic
1141475673 16:84271616-84271638 GGAGAGAGCAAGGGTGGGGATGG + Intergenic
1141524053 16:84599939-84599961 AGAGAGGGCAAGGCTGGGGAAGG + Intronic
1142111214 16:88332698-88332720 TGAGATGGGCAGGATGGGGGAGG + Intergenic
1142169077 16:88611060-88611082 GGAGATGGCAAGAGAGAGGCAGG - Intronic
1142471848 17:169063-169085 TGAGAGGCCCAGGGCGGGGCAGG - Intronic
1142472713 17:172231-172253 TGAGAGGGAAAGAGAGGGGCAGG - Intronic
1142993740 17:3748849-3748871 GGAGATGGGAATGGAGGGGCGGG + Intronic
1143305425 17:5942714-5942736 GGAGATGAAAGGGGTGGGGCAGG + Intronic
1143606579 17:7990238-7990260 TGTGAAGGCCAGGGTGCGGCAGG - Intergenic
1144127635 17:12217781-12217803 TGGGAGGCCAAGGGTGGGGGGGG + Intergenic
1144208369 17:12994880-12994902 TGAAACTGAAAGGGTGGGGCTGG + Exonic
1144700014 17:17331223-17331245 TGAGATGGCAGGGGTGACACTGG - Intronic
1144849859 17:18238603-18238625 CGAGATGGTAAGGCAGGGGCAGG + Exonic
1145774443 17:27518166-27518188 GGAGTTGGCAAGGGGGGAGCTGG + Intronic
1145784433 17:27584912-27584934 TCAGTTGGCAAGGGTGTGGCTGG - Intronic
1146315878 17:31806429-31806451 TATGATGGCAGGGGTGGGGTGGG - Intergenic
1146936106 17:36813545-36813567 TGAGAAGGGAAGGGAGGGACAGG + Intergenic
1146949004 17:36892810-36892832 GGAGAGGGTCAGGGTGGGGCAGG - Intergenic
1147255038 17:39176335-39176357 TGACATGGCAGGGGAGGGACTGG - Intronic
1147299918 17:39518271-39518293 TCAGAAGGCTAAGGTGGGGCCGG - Intronic
1147366606 17:39963311-39963333 TGGGAGGGCCAGGATGGGGCAGG - Intronic
1147385304 17:40077624-40077646 TCAGGTGGCAGGGGAGGGGCAGG - Intronic
1147855304 17:43475343-43475365 GGTGATGGCAGGGGTGGGGGTGG + Intergenic
1148031878 17:44627607-44627629 TGAGCTGGCAAGGGTGGGTGGGG - Intergenic
1148157612 17:45432644-45432666 TGGGAAGGGAAGGGTGCGGCAGG - Intronic
1148206141 17:45781450-45781472 TGAGAAGGCAAGGGAGGGATGGG + Intergenic
1148752303 17:49952247-49952269 TGAGATGGCAAGCGAGGGCTTGG - Intergenic
1149329563 17:55567285-55567307 TGAGATGATGAGGGAGGGGCAGG + Intergenic
1149540266 17:57463217-57463239 TGAGAGGGAAGGCGTGGGGCTGG + Intronic
1149763094 17:59250944-59250966 TGGGAGGGCAAGGGGGGGTCAGG - Intronic
1149849913 17:60028231-60028253 TGAGAGGCCCAGGGAGGGGCAGG + Intergenic
1149860255 17:60118293-60118315 TGAGAGGCCCAGGGAGGGGCAGG - Intergenic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1150287064 17:63960534-63960556 GGAATTGGGAAGGGTGGGGCAGG + Intronic
1150306024 17:64085988-64086010 TGTGAAGGGAAGGGTGGAGCTGG - Intronic
1150617172 17:66781294-66781316 GGAGGTGTCCAGGGTGGGGCTGG + Intronic
1151318088 17:73336296-73336318 GGAGGTGGCAGGGGTGGAGCAGG + Exonic
1151405404 17:73882864-73882886 TAAGATGGGGAGGGTGGGGGTGG - Intergenic
1151714547 17:75824838-75824860 TGAGCAGGGAAGGGTGGGACTGG + Exonic
1151894228 17:76969361-76969383 GGAGAAGGCAGGGCTGGGGCGGG - Intergenic
1152660341 17:81539161-81539183 TGTGATGGCGAGTGAGGGGCTGG + Intergenic
1152773872 17:82187758-82187780 GGAGCTGGCAGGAGTGGGGCAGG + Intronic
1153256770 18:3179517-3179539 TGAAATGGAGAGGGTGGGACTGG + Intronic
1154202872 18:12311173-12311195 AGGGATGGGAGGGGTGGGGCTGG - Intronic
1157192044 18:45589815-45589837 GGAAGTGGCAAGGCTGGGGCAGG + Intronic
1157279891 18:46339876-46339898 TGGGAAGGACAGGGTGGGGCAGG - Intronic
1157334208 18:46725526-46725548 TTAAATGGCACGGGTGGGGGGGG + Intronic
1157739509 18:50079936-50079958 TGAGATGACAAGTATGGGGAGGG + Intronic
1158176042 18:54657022-54657044 TGAAACAGCAAGGGTGGGGGTGG - Intergenic
1158681436 18:59570671-59570693 TGTGCTGGCGGGGGTGGGGCAGG + Intronic
1159871070 18:73760140-73760162 TGAGCTGGCCAGTGAGGGGCTGG - Intergenic
1159931308 18:74315613-74315635 TGAGCTGGTGTGGGTGGGGCCGG - Intergenic
1160904176 19:1444858-1444880 TGAGACGGCACAGATGGGGCCGG - Intergenic
1161143246 19:2661414-2661436 TGGGAGGCCAAGGTTGGGGCAGG + Intronic
1161288531 19:3480632-3480654 GGAGCTGGCAGGGGAGGGGCAGG - Intergenic
1161803192 19:6427042-6427064 TGAGACAGCCAGGGTGGGGCGGG + Intronic
1161846480 19:6714090-6714112 AGAGATGGCGTTGGTGGGGCCGG + Intronic
1162059557 19:8086327-8086349 TGAGATGGGAGGGGTGAGGCAGG + Intronic
1162078105 19:8202364-8202386 TCAGAGGGAAAGGGTGGGGAGGG + Intronic
1162269618 19:9603618-9603640 TGAGAGGGGAAGGGAGGGGGGGG + Intergenic
1162461723 19:10817626-10817648 TGACGTGGCAAGGCTGGGGCCGG + Intronic
1162586851 19:11565037-11565059 TGGGGTGGAGAGGGTGGGGCAGG - Intronic
1162779207 19:12997803-12997825 TGACATGGCTAGGAAGGGGCTGG + Intronic
1162835809 19:13317078-13317100 GGAGTTGGCAGGGGTGGGGCTGG + Intronic
1163289777 19:16371669-16371691 GGAAGTGGCAAGGGTGGGGCCGG + Intronic
1163298106 19:16425342-16425364 TGAAGGGGCAAGGCTGGGGCCGG + Intronic
1163298595 19:16429140-16429162 TGAGAATGCAAGGGAGGGGTGGG - Intronic
1163357864 19:16826166-16826188 GGAGATGGCAGGGGTTGGGGTGG - Intergenic
1163451020 19:17377464-17377486 TGAGAAGGCGGGGGTGGGGCTGG + Intergenic
1164156779 19:22602053-22602075 GGAGGGGGCAAAGGTGGGGCAGG - Intergenic
1164527424 19:29022383-29022405 ACAGCTGGTAAGGGTGGGGCTGG + Intergenic
1164539164 19:29109390-29109412 AGAGGGGTCAAGGGTGGGGCGGG + Intergenic
1164909364 19:31993014-31993036 TGAGATGGTCAGGGAGGGGAGGG - Intergenic
1165174087 19:33914432-33914454 GGAGGTGGCAGGGGCGGGGCTGG + Intergenic
1165347371 19:35257354-35257376 GGCGATGGCAGGGGTGAGGCTGG + Intronic
1165791030 19:38492657-38492679 GGAGAGGGCAGGGGTGGGGTGGG + Intronic
1165810911 19:38611192-38611214 AGAGAGGGCAGGGCTGGGGCTGG - Intronic
1165862711 19:38917678-38917700 AGGGATGGCAGGGGTGGGGTAGG - Intronic
1166171456 19:41030176-41030198 TGACCTGGCCAGGGTGGGGGTGG + Intergenic
1166345604 19:42163403-42163425 TAAGCTGGCAAGGATGGAGCAGG + Intronic
1166365963 19:42278673-42278695 TGATATGCACAGGGTGGGGCTGG - Intronic
1166541350 19:43607898-43607920 AGAGCTGGCAAGGCTGGGCCGGG + Exonic
1166742104 19:45120858-45120880 TGAGAGGCCAAGGCTGAGGCAGG - Intronic
1166921551 19:46232232-46232254 TGAGAGGGAGTGGGTGGGGCGGG + Intergenic
1167216566 19:48169750-48169772 GGAGGTGCCAAGGGTGGGGCTGG - Intronic
1167638577 19:50668345-50668367 TGACATGGCCGGGGCGGGGCTGG + Exonic
1168703935 19:58457518-58457540 TGAGATGGAGGGGGTGGGGGTGG - Exonic
925196627 2:1931135-1931157 AGAGAGGAGAAGGGTGGGGCCGG + Intronic
925990601 2:9251275-9251297 TGAGGTTGTGAGGGTGGGGCTGG + Intronic
926034073 2:9620790-9620812 AGAAATGGGAAGGGTGGGGAAGG + Intronic
926128593 2:10286492-10286514 TGAGATGGCAGGGGAGGGAAAGG + Intergenic
926167657 2:10531439-10531461 TTAGATGAAAAGGGTGGGGCCGG + Intergenic
927102618 2:19799596-19799618 TGAGGAGGCAACGCTGGGGCTGG + Intergenic
927192386 2:20525491-20525513 TGAGATGTCAATTGTGGAGCAGG - Intergenic
927826798 2:26314883-26314905 TAAAATGGCAGGGGTGGTGCAGG - Intronic
928611865 2:32999197-32999219 TCAGTTGGTAAAGGTGGGGCCGG - Intronic
929081859 2:38129359-38129381 TGAAATGGCTAGGCTGGAGCTGG - Intergenic
929533904 2:42768670-42768692 TGGGAGGGCAAGAGTGGTGCAGG - Intronic
932231580 2:70087928-70087950 AAAGATGGCATTGGTGGGGCCGG - Exonic
932404387 2:71503800-71503822 TGAGAAGGCCAGGGAGGGGCAGG - Intronic
932696912 2:73964682-73964704 TCTGGTGGCAGGGGTGGGGCAGG - Intergenic
933356681 2:81219005-81219027 TGAGAAGGGTAGTGTGGGGCTGG - Intergenic
933663490 2:84946144-84946166 TGAGAGGGGAAGGGAGGGGAGGG + Intergenic
933702147 2:85263235-85263257 GGAGATGGGAAGGGTAGGCCAGG + Intronic
933933870 2:87183850-87183872 TTAGACGGCAAAAGTGGGGCAGG + Intergenic
934713965 2:96532493-96532515 GGAGATGGGCAGGGTGTGGCTGG + Intergenic
934906630 2:98210658-98210680 TGAGATGCCTTGGGTGGGGTGGG + Intronic
935717828 2:105954121-105954143 TGAGGTGGTAAGGGATGGGCAGG + Intergenic
936277885 2:111116586-111116608 TGTGAGGGCAAAGGTGGGGCTGG + Intronic
936359238 2:111781595-111781617 TTAGACGGCAAAAGTGGGGCAGG - Intronic
936865932 2:117076852-117076874 TGAGATGGGAAGGGAAGGGAAGG - Intergenic
937157818 2:119733820-119733842 TGTGGTAGGAAGGGTGGGGCAGG - Intergenic
937892287 2:126948054-126948076 TGAGATGGGAAGCCAGGGGCAGG - Intergenic
938062164 2:128262516-128262538 TGAAATGGGAAGGCTGGGCCAGG - Intronic
938102573 2:128507117-128507139 TATGGAGGCAAGGGTGGGGCAGG + Intergenic
938936506 2:136132119-136132141 TGATTTGGCAGGGTTGGGGCGGG + Intergenic
939787904 2:146539213-146539235 GGAGAAGGCAAGGCTGGAGCAGG + Intergenic
941379875 2:164779558-164779580 GGAAATGGCATGGGTGGGGCAGG - Intronic
941466137 2:165829493-165829515 TGAGAAGGTAAGGGTGGGCTGGG + Intergenic
942832185 2:180250516-180250538 AGAGAGGGCAAGAATGGGGCAGG - Intergenic
943069010 2:183119443-183119465 AGAGTTGGCATGGCTGGGGCAGG + Intronic
943149342 2:184091885-184091907 TCAGATGGTAAGGGTGGAGTTGG + Intergenic
943703064 2:191006954-191006976 TGGGAAGGCAAGGAGGGGGCAGG - Intronic
945066519 2:205952314-205952336 TGAGATGGAAAATGTGGGGAGGG + Intergenic
945774797 2:214092809-214092831 GGAGATGGCAAGGCTGGAGGAGG + Intronic
946081678 2:217125455-217125477 TGAGATGGAAGGGGAGGGGAAGG + Intergenic
946176874 2:217927706-217927728 AGAGAAGTCAAGGGTGGGGATGG - Intronic
946245278 2:218383886-218383908 GGAGCTGGCAAGGGAGGAGCTGG + Intronic
946251816 2:218418630-218418652 TCAGAAGCCAAGGGAGGGGCTGG + Intergenic
946325009 2:218980688-218980710 TGAGATGGGGAGGGTTGGGTGGG + Intergenic
946375759 2:219308250-219308272 AAAGAGGGCATGGGTGGGGCTGG + Intronic
947081999 2:226409479-226409501 GGAGAAGGTAAAGGTGGGGCTGG - Intergenic
947108147 2:226689554-226689576 TCAGAGGGAAAGGGTGGGACGGG + Intergenic
947479339 2:230483598-230483620 TAGGAGGGCAAGGATGGGGCAGG + Intronic
947500720 2:230668847-230668869 TGAGAAGGCAAGGGGGGTGAGGG + Intergenic
947527217 2:230886125-230886147 TGACATGGCCAGGGTGGGCAGGG - Intergenic
947565420 2:231190247-231190269 TGAGAAGTCAGGGGTGGAGCTGG - Intergenic
947606779 2:231491245-231491267 TGAGATGGCAGGGCAGGGCCAGG - Intergenic
947750625 2:232530195-232530217 TGAGGGGGCAGGGCTGGGGCTGG - Intronic
948190548 2:236054897-236054919 TGAGATACAAAGGCTGGGGCTGG - Intronic
948469367 2:238167403-238167425 AGAGGTGGAAAAGGTGGGGCTGG - Intronic
948766860 2:240226919-240226941 TGGGCTGGCAGGGGTGGTGCAGG - Intergenic
948812849 2:240493721-240493743 AGAGGTGGCAAGGATGGGGTAGG + Intronic
948894239 2:240920945-240920967 GAAGATGGCATGGGTGTGGCAGG - Intronic
948921359 2:241067453-241067475 TGACATGGCAGGGGATGGGCCGG - Intronic
949015755 2:241709376-241709398 CGAGATGGTGAGGGCGGGGCGGG + Exonic
949068985 2:242012103-242012125 AGCGATGGCAATGGTGGGACAGG + Intergenic
1168811001 20:704544-704566 TGAGTTGGGGAGGATGGGGCTGG - Intergenic
1168842891 20:921106-921128 GGAGTTGCCAAGGGAGGGGCTGG - Intergenic
1168893446 20:1308606-1308628 TGGGAGGGCAAAGATGGGGCGGG + Exonic
1169482294 20:5995465-5995487 AGAAGTGGCAAAGGTGGGGCAGG - Intronic
1169522183 20:6386020-6386042 TGAGGGGACAAGGGAGGGGCAGG - Intergenic
1169938086 20:10906361-10906383 TGTGATGGCAGGGGTGTGGGTGG - Intergenic
1169952287 20:11058620-11058642 TGAGATGCCAAGTTTGGGGCTGG - Intergenic
1170127104 20:12976124-12976146 TGAGAAGGCTAGGTTGGGGTTGG - Intergenic
1170329466 20:15192511-15192533 TGAGGTGGCAGAGGTGGTGCTGG - Intronic
1170530245 20:17284075-17284097 TGAGATGGCAATGGTGGGGGTGG - Intronic
1170836082 20:19885967-19885989 GGGGATGGGAAGGGTGGGGAAGG + Intergenic
1171406696 20:24916589-24916611 TGAGCAGGCAAAGGTGGGGTTGG - Intergenic
1172032033 20:31989127-31989149 TGAGTTGGCAAGGGTGGCCTGGG + Intronic
1172126845 20:32629520-32629542 TAAGCTGGAGAGGGTGGGGCAGG + Intergenic
1172132388 20:32664447-32664469 TGGGGTGGCAGGGCTGGGGCTGG - Intergenic
1173187302 20:40850302-40850324 TGAGAAGACAAGGGTGTGGGAGG + Intergenic
1173328971 20:42058546-42058568 TGAGATGGTGAAGGAGGGGCTGG - Intergenic
1173708777 20:45136222-45136244 TGCCATGGGAAGGGTAGGGCAGG - Intergenic
1173912980 20:46684048-46684070 TGAGATGGGAGAGGCGGGGCCGG - Intronic
1173938296 20:46888087-46888109 TGAGAGGGCCAGCGTGGAGCTGG + Intergenic
1174048028 20:47747752-47747774 AGAGATGGGAAGGCGGGGGCAGG - Intronic
1174075664 20:47934205-47934227 TGGGATGGCAATGGGGGGACAGG - Intergenic
1174411485 20:50339497-50339519 GGAGAAGGCATGGGTGGGGAAGG + Intergenic
1174615510 20:51832474-51832496 TGGGAGGGCCAAGGTGGGGCTGG + Intergenic
1174879987 20:54268480-54268502 TGAGATTGCAAGGCTGGGTGAGG - Intergenic
1175181049 20:57147946-57147968 TGACATGGCAGAGGAGGGGCTGG - Intergenic
1175192070 20:57218043-57218065 GGAGATGGCAAGGCCAGGGCCGG + Intronic
1175308938 20:57998047-57998069 TGAGGTGGGGAGGGTTGGGCTGG + Intergenic
1175551764 20:59822219-59822241 TGGGATGGCAGGGGAGGGGGTGG - Intronic
1175764302 20:61582169-61582191 TGGGATGACCAGGGAGGGGCAGG - Intronic
1175858331 20:62134744-62134766 AGTGATGTCAAGGTTGGGGCTGG + Exonic
1175915742 20:62424898-62424920 TGAGCTGGCTGGGGCGGGGCAGG + Intronic
1175930129 20:62489941-62489963 TGAGTTGGAATGGGTGGGTCTGG - Intergenic
1176098880 20:63356145-63356167 GGACAGGGCCAGGGTGGGGCAGG + Intronic
1176098928 20:63356259-63356281 AGGGAGGGCAGGGGTGGGGCAGG + Intronic
1176098959 20:63356329-63356351 GGGGAGGGCAGGGGTGGGGCAGG + Intronic
1176151859 20:63595559-63595581 GGCCATGGCCAGGGTGGGGCTGG + Intronic
1176165538 20:63671400-63671422 AGAAAAGGCAGGGGTGGGGCTGG + Intronic
1176243887 20:64088221-64088243 GGAGCTGGCTGGGGTGGGGCAGG + Intronic
1176292803 21:5055263-5055285 TCAGAGGGCAAGGGAGGGCCAGG - Intergenic
1177669700 21:24209081-24209103 TGGGCTGGCGAGGCTGGGGCCGG - Intergenic
1177994734 21:28082964-28082986 TGGGATGGCATGGGAGGGGATGG + Intergenic
1178442519 21:32610499-32610521 TCAGAAGACAAGGATGGGGCCGG - Intronic
1178470192 21:32885701-32885723 TGGGATGGCAGGAGTGGGGAGGG - Intergenic
1179864457 21:44208387-44208409 TCAGAGGGCAAGGGAGGGCCAGG + Intergenic
1179958842 21:44757094-44757116 AGAGGTGGCGAGGGTGGGCCTGG - Intergenic
1180094447 21:45549619-45549641 TGATGTGGCAGGGGAGGGGCAGG + Intergenic
1180142384 21:45900327-45900349 ACAGCTGGCAAGGGTGGCGCAGG - Intronic
1180625402 22:17190677-17190699 GGAGAGGCCATGGGTGGGGCAGG - Intronic
1180636599 22:17266972-17266994 TGAGATGGGAGGGTTGGGGTGGG - Intergenic
1180693927 22:17739889-17739911 TGAGAGGGCAAAAGTGGGTCTGG - Intronic
1181055356 22:20258315-20258337 AGGGGTGGCAGGGGTGGGGCTGG - Intronic
1181132899 22:20744140-20744162 TGTGATGGCACTGGTGAGGCTGG + Intronic
1181974605 22:26720075-26720097 GCAGGTGGCAAAGGTGGGGCAGG - Intergenic
1182548043 22:31086879-31086901 CCAGGTGGCAAGGGTGGGGATGG - Intronic
1183316351 22:37139089-37139111 TGAGGAAGCCAGGGTGGGGCTGG - Intronic
1183332453 22:37228790-37228812 GGAGAAAGGAAGGGTGGGGCAGG + Intronic
1183734407 22:39635888-39635910 TGTGATGGCGAGCTTGGGGCTGG - Intronic
1184188147 22:42878104-42878126 TGAGACGGCACTGGTGGGGGCGG + Intronic
1184693227 22:46126755-46126777 TGAGATGCCAAGGTGGGGGTGGG - Intergenic
1184856388 22:47148857-47148879 GGAGGTGGCAAGGCTGGGTCAGG - Intronic
1184998460 22:48227373-48227395 TCAGATGGGAAGGCTGGGTCGGG + Intergenic
1185110563 22:48897970-48897992 TGTGATGGCTGGGTTGGGGCTGG + Intergenic
1185302211 22:50087827-50087849 TGAGAAGACCAGGGTGGAGCAGG + Intergenic
1185371882 22:50464745-50464767 GGAGACGGCAGGTGTGGGGCAGG + Intronic
949491606 3:4594709-4594731 TGAGACGGCCATGGTGGGGGTGG - Intronic
949502002 3:4688798-4688820 TGAGATGGCAGGAGTTGGGGAGG + Intronic
950652195 3:14414211-14414233 TGAGATGGCTACATTGGGGCAGG - Intronic
951258864 3:20482591-20482613 GGTGTTGGCAGGGGTGGGGCTGG - Intergenic
951574831 3:24102889-24102911 GTAGAAGGCAAGGGGGGGGCAGG - Intergenic
951584458 3:24201232-24201254 AGAGTTGGCGAGGTTGGGGCTGG + Intronic
952392814 3:32894972-32894994 TCAGGTGGCAAGGGTTGGGTGGG + Exonic
952580038 3:34822820-34822842 TTCGATGGCATGGATGGGGCTGG + Intergenic
952738843 3:36716456-36716478 TGATGTGGCAGTGGTGGGGCTGG - Intronic
952955790 3:38556394-38556416 TGGGCTGGGTAGGGTGGGGCCGG - Intronic
953334235 3:42080293-42080315 TGAGTTGAGAAGAGTGGGGCAGG + Intronic
953512972 3:43562154-43562176 TGAGATGGAAAGTTTGAGGCCGG + Intronic
953862837 3:46560070-46560092 TGGGATGCCAAGGGCTGGGCTGG - Intronic
954036445 3:47853508-47853530 TGAGGTGGGGTGGGTGGGGCCGG - Intronic
954373891 3:50184294-50184316 GGAGATGACAGGGGTGGGGAGGG + Intronic
954390271 3:50264916-50264938 GGGGAGGGCAGGGGTGGGGCAGG + Intergenic
954676642 3:52319536-52319558 TGAGATGGCAGGGGTGGCCCTGG - Intronic
954752013 3:52819134-52819156 TGAGACGCTAAGGATGGGGCAGG + Exonic
954753888 3:52828564-52828586 TGAGTTGGGAAGGGTAGGGGAGG + Intronic
955601971 3:60655225-60655247 GGAGGTGGGAAGGGTGGGACTGG + Intronic
955910645 3:63856261-63856283 TGTGGTGGCAGGGGAGGGGCGGG + Intronic
956670794 3:71687628-71687650 AGAATTGGCCAGGGTGGGGCTGG + Intronic
957130996 3:76222475-76222497 TAAGATCTCAAGGGTTGGGCGGG - Intronic
959396011 3:105839011-105839033 TGAGGTGGCACAGGTGGGGATGG - Intronic
959600007 3:108171228-108171250 TGAAATGACAAGGGTGAGACTGG - Intronic
959871517 3:111333848-111333870 TGATCTGGCAAAGGAGGGGCTGG + Intronic
960191058 3:114706781-114706803 TGAGATAACAAGGGTGAGTCAGG + Intronic
960326652 3:116304546-116304568 TGAGCTGGGAAGCGTGGGTCAGG + Intronic
961091838 3:124119576-124119598 TCAGATCGCAAGGATGGGGGAGG + Intronic
961322034 3:126083234-126083256 TTAGAAGGTCAGGGTGGGGCTGG + Intronic
961523688 3:127483377-127483399 TGAGAGGTCACAGGTGGGGCTGG - Intergenic
961651297 3:128417955-128417977 TGGGCTGGCAAGGCTGGGGAAGG - Intergenic
961826940 3:129604077-129604099 TGACATGACAAGGGTGCGGGAGG - Intronic
961840159 3:129703590-129703612 TGAGTTTGCAAGGTTGAGGCTGG + Intronic
962320033 3:134382472-134382494 TGACCTGGCAAGGTTGGGGCTGG + Intergenic
962385564 3:134929684-134929706 TGTGATGGCATGGCTGGGACTGG + Intronic
962829453 3:139127350-139127372 TGAGATATCTAGGGTGGAGCTGG + Intronic
962829689 3:139129092-139129114 TGACATTGGAAGGGTGGGGAGGG + Intronic
962954244 3:140249445-140249467 TGACAAGGCAAGGTTGGGGCAGG + Intronic
963855454 3:150248789-150248811 TGAGAGGTCAGGGGTGGGGAAGG + Intergenic
964470608 3:157050392-157050414 TGAGATGGAAAGGCTGGAGATGG + Intergenic
965057779 3:163744309-163744331 TGTGAGGGCAAAGGTGAGGCTGG - Intergenic
966007429 3:175033112-175033134 TGAGATAGCAAGGTTGGTGGTGG + Intronic
967080621 3:186046221-186046243 TGAGAGGGCTAGGGCGGGGGCGG + Intergenic
967402900 3:189083370-189083392 AGAGAAGGAAAGGGAGGGGCAGG + Intronic
967640957 3:191862380-191862402 CCAGGTGTCAAGGGTGGGGCCGG - Intergenic
968451891 4:679805-679827 GCAGATGGGAAGGGTGGGGAGGG - Intronic
968473232 4:791443-791465 TGGGAGGGCAGGGGCGGGGCAGG - Intronic
968683483 4:1938606-1938628 TGAAAGGGGAAGGCTGGGGCTGG + Intronic
968985838 4:3873863-3873885 GGGGATGGTCAGGGTGGGGCCGG + Intergenic
969042186 4:4307683-4307705 TGAGATGAAAACGGTGGGGGCGG - Intronic
969231979 4:5838434-5838456 TGTGATGGGTAGGGTGGGGTGGG + Intronic
969281005 4:6170726-6170748 TGTGGTGGCAAGGGTGGTGATGG - Intronic
969507219 4:7595532-7595554 TGAGATGGCTGGTGCGGGGCGGG - Intronic
970657967 4:18252988-18253010 GGAGATGCCAAGGGTGGGAGTGG - Intergenic
972225987 4:37012526-37012548 GGTGAGGGCAAGGGTGGGGATGG + Intergenic
974283137 4:59825267-59825289 TGGGCTGGCAAGGGTGGGGTAGG + Intergenic
974713183 4:65630254-65630276 TGAGATCTCAAGAGTTGGGCGGG + Intronic
975090901 4:70402867-70402889 TGAGATGGGAAGAGAGGAGCAGG + Intronic
978348872 4:107800357-107800379 TGAGTTGGAAAGGGTGGAGCAGG + Intergenic
979477890 4:121179808-121179830 TGTGGTGGCCAGGGTGGGGGAGG + Intronic
979552214 4:122003758-122003780 TGCGAGGGCAAGTGTGGAGCTGG - Intergenic
980958742 4:139454019-139454041 TGTGCGGGCAAGGGCGGGGCGGG + Exonic
981052808 4:140327820-140327842 TGAAATGGCAAGTTTGGGGCTGG + Intronic
981720628 4:147797904-147797926 TGAGATGGCATGGGATGGGTTGG - Intronic
982106266 4:152014424-152014446 TGTGGTGGCAGGGGCGGGGCTGG + Intergenic
982182116 4:152758550-152758572 TGAGATTGTAAGGGTGAGGAAGG - Intronic
982496396 4:156098843-156098865 TCCCATGGCAAGTGTGGGGCCGG + Intergenic
984022906 4:174507528-174507550 TGAGATGCCAAGGTTGGGGTGGG + Intronic
984281321 4:177674104-177674126 TGAGATGTAAAAGGTGGGGAAGG + Intergenic
985495042 5:199552-199574 TGGGCTGGCAGAGGTGGGGCGGG - Exonic
985552071 5:538788-538810 TGTGATGGCACGGTTTGGGCTGG + Intergenic
985973995 5:3400917-3400939 AGAGATGCTAAGGGCGGGGCTGG - Intergenic
986156056 5:5177050-5177072 AGAGGAGGCAAGGGTGAGGCAGG - Intronic
986292628 5:6412166-6412188 TCAGATGGCAGGGGTGGGTGGGG + Intergenic
986336287 5:6758340-6758362 TGCGGTGGGCAGGGTGGGGCTGG + Intergenic
986622641 5:9691659-9691681 TAAAATGGCCAGGCTGGGGCTGG + Intronic
987195521 5:15522197-15522219 GGTGAGGGCAAGGGAGGGGCAGG - Intronic
987299121 5:16581137-16581159 TGAGATTGGAAGGGAGAGGCTGG + Intronic
987412260 5:17626124-17626146 TGAGTTGGTAAGTATGGGGCTGG - Intergenic
989109703 5:37895496-37895518 TGAAACAGCAAGGGCGGGGCAGG - Intergenic
992659668 5:78945859-78945881 TGAGATGGAAAGGTTGGGAATGG - Intronic
993478010 5:88388785-88388807 TGGGGTGGCAAGGGTGGGGAAGG + Intergenic
994248045 5:97503584-97503606 AGAGAAGGCAAGGGGGGGGGAGG - Intergenic
995708910 5:115014827-115014849 TGTGATGGCATGGGAGAGGCTGG - Intergenic
995729774 5:115226072-115226094 TGAGTTGGCGGGGGTGGGGGTGG + Intronic
995921634 5:117321688-117321710 TGAGGTGGCAGGGGGTGGGCAGG - Intergenic
997231934 5:132251671-132251693 AGAGATAGAAAGGATGGGGCAGG + Intronic
997362864 5:133306184-133306206 TGAGGTGGCAGGAGTTGGGCCGG + Intronic
997367673 5:133336227-133336249 GGAGGAGGCAAGGGTGGGGTGGG + Intronic
997398204 5:133581478-133581500 TGATGTGGCACGTGTGGGGCAGG - Intronic
998393485 5:141803168-141803190 TCAGGTGGGAAGGGTGAGGCAGG - Intergenic
998401963 5:141852865-141852887 TGAGAGGGCAGGGAGGGGGCAGG + Intergenic
998822612 5:146070291-146070313 TGAGTTTGCTAGGATGGGGCTGG + Intronic
998845943 5:146309968-146309990 TAAGATAGAAAGGGTCGGGCCGG - Intronic
999262327 5:150245587-150245609 AGAGAGGGCCAGGGTGGGGAGGG - Intronic
999738704 5:154532680-154532702 AGAGGTGGCATGGGTGGAGCAGG + Intergenic
999776437 5:154816077-154816099 TGGGAGGGCAAAGGTGGGGAAGG - Exonic
1001330765 5:170760815-170760837 TCAGATATCAAGGGTGGGGTGGG - Intergenic
1001567035 5:172706580-172706602 GGAGAGGGAAACGGTGGGGCGGG - Intergenic
1002449299 5:179309953-179309975 CCAGAGGGCAGGGGTGGGGCAGG - Intronic
1002538287 5:179890339-179890361 TGAGATGTCAAGGGCCCGGCAGG + Intronic
1002643367 5:180641040-180641062 AGAGATGGCAAGGCGAGGGCAGG - Intronic
1003233128 6:4272616-4272638 TGAGATGGCGGGGGTGGGGGGGG - Intergenic
1003952658 6:11130516-11130538 TCAGCTGGCCAGGGTGGGGAGGG + Intronic
1003961201 6:11210967-11210989 TGACATGGCCAGGATGGGGAGGG - Intronic
1003961338 6:11211891-11211913 TGACATGGCCAGGATGGGGAGGG + Intronic
1004138613 6:12992794-12992816 TGAAATGCCCGGGGTGGGGCAGG + Intronic
1004344625 6:14837205-14837227 TGAGAAGGCAAGAGAGGGGTGGG + Intergenic
1005039233 6:21587145-21587167 AGGGATGGGAGGGGTGGGGCAGG - Intergenic
1005754575 6:28914567-28914589 TGAAATTGCAAGGGTGGGGGGGG + Intronic
1005886812 6:30103271-30103293 TAAGAAGTCAAGCGTGGGGCGGG + Exonic
1006268516 6:32945627-32945649 GTAGATGGCAGGGGTGGGGTGGG - Intronic
1006369030 6:33633200-33633222 TGAGATGGCAGGAGTGGGATGGG + Intronic
1006565278 6:34950767-34950789 TCAGATAGCAAGGATGGGGGTGG + Intronic
1006732942 6:36250087-36250109 GGAGATGACAAGGAAGGGGCTGG - Intronic
1007406389 6:41638369-41638391 TGAGAAGGCGAGGAGGGGGCGGG + Intronic
1007474015 6:42107241-42107263 AGAAAGGCCAAGGGTGGGGCAGG + Exonic
1007745216 6:44039395-44039417 TGCGCTGGCCATGGTGGGGCTGG + Intergenic
1007763966 6:44150312-44150334 TGAGTTGAGAAGGATGGGGCAGG + Intronic
1007798300 6:44369300-44369322 TGAGAGGCCAAGGGTGGGGTGGG + Intronic
1008074633 6:47132857-47132879 AGATATGGCAAGGGTGAGGAAGG + Intergenic
1010229417 6:73521528-73521550 CGAGATGGCAAGGCTGAGGACGG - Intronic
1012448593 6:99331438-99331460 AGAGATGGAAAGGGCAGGGCAGG + Intronic
1014108909 6:117598432-117598454 TAAGTTGGGAAGGGTGAGGCGGG + Intronic
1015314118 6:131797677-131797699 TGAGATGGTAGGGGTAGGGGAGG - Intergenic
1015541704 6:134320718-134320740 GGAGGGGGGAAGGGTGGGGCTGG + Intergenic
1016827833 6:148404725-148404747 GGAGAGGGGAACGGTGGGGCTGG - Intronic
1016975110 6:149800030-149800052 TTAGAGAGCAAGGGTGGGGTAGG + Intronic
1017599162 6:156062018-156062040 TGAGTTCGCAAGGAGGGGGCAGG - Intergenic
1017667959 6:156739673-156739695 TGAGGTCGTAAGAGTGGGGCTGG - Intergenic
1017699059 6:157050117-157050139 TGAGATGGAAACTGTGGGGATGG - Intronic
1017747257 6:157458035-157458057 TGGGATGGAAAGTGGGGGGCAGG - Intronic
1018298626 6:162376758-162376780 TGAGAGGGAAAGGGAGGGGGAGG + Intronic
1018647128 6:165959286-165959308 TGAGCTGGATAGGGTGGGGATGG + Intronic
1018812183 6:167306320-167306342 TGACCAGGCCAGGGTGGGGCAGG + Intronic
1018839818 6:167508879-167508901 TGGGATGGGAAGGGAGGGGACGG - Intergenic
1019139730 6:169935855-169935877 TAAGAGGGCAAGTGTGGGGACGG - Intergenic
1019271718 7:153033-153055 TGGGGAGGGAAGGGTGGGGCTGG - Intergenic
1019278703 7:189160-189182 GGAAATGCCAAGGCTGGGGCAGG - Intergenic
1019292853 7:258783-258805 TGTGATGGCCGGGGTGGGGTGGG - Intronic
1019641596 7:2106428-2106450 TGGGAAGGGCAGGGTGGGGCCGG - Intronic
1020736016 7:11950179-11950201 TGATATGGCAAGGGTATGGGGGG + Intergenic
1021215299 7:17908855-17908877 TCAGCTAGAAAGGGTGGGGCAGG + Intronic
1022013613 7:26329953-26329975 GGAGATGGGAAGGGTGGGTCAGG + Intronic
1022806080 7:33824026-33824048 TGGGATGGCAAGGTTGGGTCTGG + Intergenic
1024524429 7:50336393-50336415 GGAGGTGGCAGGAGTGGGGCGGG + Intronic
1025107024 7:56179817-56179839 TGATATGGGAAGGCTGAGGCAGG + Intergenic
1026139409 7:67692556-67692578 TGTTTTGGCAAGGGTGGGGCCGG + Intergenic
1026320726 7:69265720-69265742 TGAGCAGGTAAGGGTGGGGCAGG - Intergenic
1026326804 7:69317644-69317666 TGAGACGCGAAGAGTGGGGCTGG - Intergenic
1027292313 7:76727982-76728004 CGAGATGCCAGGGGTGGGGCAGG - Intergenic
1027810354 7:82888952-82888974 AGAGTTGGCGGGGGTGGGGCAGG - Intronic
1028694295 7:93690936-93690958 TGAGGTCTCAAGGCTGGGGCAGG + Intronic
1028987180 7:97017738-97017760 TGCGATGTCAAGAGTGGGGCCGG + Intergenic
1029374172 7:100167959-100167981 GGAGACTGAAAGGGTGGGGCTGG + Intronic
1029402196 7:100353296-100353318 TGAGGTGGCAGGGGTAGGGGGGG + Intronic
1030308728 7:108047314-108047336 AGAGATGGCAGGGGTGGAGGAGG - Intronic
1030697735 7:112604023-112604045 AGAGATGGGAAGGGTAGGGGAGG - Intergenic
1032061239 7:128727121-128727143 TGAGATGAGAAGGGCTGGGCTGG - Intronic
1032205610 7:129862508-129862530 AGAAATGGAAAGGTTGGGGCGGG + Intronic
1032797850 7:135291842-135291864 TTACATGGCAGGGGTGGGGAGGG - Intergenic
1033282597 7:140016763-140016785 TGATCTGGCAAGGGAAGGGCTGG + Intronic
1034293196 7:149948519-149948541 TGGGATGGAGAGGGTGGGGCAGG - Intergenic
1034391918 7:150793754-150793776 ACAGATGGGAGGGGTGGGGCAGG - Intronic
1034812878 7:154148360-154148382 TGGGATGGAGAGGGTGGGGCAGG + Intronic
1034962093 7:155369166-155369188 TCAGGTGGAGAGGGTGGGGCAGG + Intergenic
1035010944 7:155714524-155714546 TGAGAGGGCCAGTGTGGTGCTGG + Intronic
1036514248 8:9429044-9429066 TCAGAGGGGAAGGGTGGGGTGGG + Intergenic
1038641403 8:29331959-29331981 TGTGGTGGCAAGGCTGAGGCAGG + Intergenic
1038860883 8:31387952-31387974 AGAGATGGGAAGGGAGGGGAGGG - Intergenic
1039079068 8:33718122-33718144 TGAAATGGACAGGGTGGGGATGG - Intergenic
1040439219 8:47423686-47423708 TGAAATGGCATGGGGTGGGCAGG + Intronic
1041471386 8:58212651-58212673 AGAAATGGCAGTGGTGGGGCAGG - Intergenic
1041806369 8:61854231-61854253 TTTGCTGACAAGGGTGGGGCGGG - Intergenic
1043333854 8:79149740-79149762 TGACATGGCAAGAGAGGGGAGGG - Intergenic
1043927222 8:86051032-86051054 TAAGTTGGCATGGGTGGGGGTGG - Intronic
1044793513 8:95872480-95872502 GGGGCTGGCAGGGGTGGGGCTGG - Intergenic
1045002008 8:97886755-97886777 GGACAGGGCAGGGGTGGGGCAGG - Intronic
1045048469 8:98301532-98301554 TGGGAAGGCAGGGGTGGAGCTGG + Intergenic
1046781321 8:118218520-118218542 GGGGATGGCAGGGGTGGGGGTGG - Intronic
1046790116 8:118312599-118312621 GGAGATGGCCATGGTGGGGATGG - Intronic
1047795822 8:128254516-128254538 TGGGGTGGCAAGGGAGTGGCAGG + Intergenic
1048185342 8:132235256-132235278 TGGGAGGCCAAGGGTGGGGGGGG + Intronic
1048220347 8:132535201-132535223 TGCCATGACAAGGGTGGGGTGGG - Intergenic
1048581497 8:135732774-135732796 TGAGAGGCCAATGGTGAGGCTGG + Intergenic
1049042978 8:140126241-140126263 TGAGATGGCCAGGGAGGGAGAGG + Intronic
1049292583 8:141812585-141812607 TGGGCTGGGAAGGGTGGGGATGG - Intergenic
1049653572 8:143788047-143788069 TGAGAAGGGCCGGGTGGGGCAGG - Intergenic
1050442965 9:5684288-5684310 TGAGATGGCGGGGGGGGGGGGGG - Intronic
1050943307 9:11486987-11487009 TCAGATGCCTAGGGTGGGACTGG + Intergenic
1051372922 9:16373506-16373528 TTAAATGGCAAGGATGGGGATGG - Intergenic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1053147934 9:35724520-35724542 TGAAATGGGAAGGGTGGGAAGGG - Intronic
1053329203 9:37188577-37188599 TGAGATGGGGAGGGTAGGGGAGG - Intronic
1053472702 9:38358239-38358261 GGAGGTAGCAAGGGTGGGGAAGG - Intergenic
1053732678 9:41074064-41074086 TGAGGTAGCAAAGCTGGGGCCGG + Intergenic
1055272192 9:74573774-74573796 TGAGAGGGAAAGGGTAGGGAAGG + Intronic
1056757360 9:89390257-89390279 TGAGATGGGGAGGGTGCTGCAGG - Intronic
1057013954 9:91633703-91633725 TGAGATGGAGAGGGTGTGCCAGG - Intronic
1057799522 9:98181709-98181731 TGAGCAGGCAAGGGTGGGGAGGG - Intronic
1058103054 9:100937930-100937952 TGAGATGACCAGGTGGGGGCAGG + Intergenic
1059455022 9:114394942-114394964 TGAGCTGGCAGTGGGGGGGCTGG + Intergenic
1059935424 9:119305670-119305692 TGAGGTGGCAAAGTTGGGGAAGG - Intronic
1060117942 9:120959555-120959577 TGAAATTGGAAGGGTGGAGCCGG - Intronic
1060422753 9:123481288-123481310 GGAGGTGGCAATGGTGGGGATGG + Intronic
1060766282 9:126296861-126296883 TGGGATGGCAGGGTTGGAGCGGG - Intergenic
1060973733 9:127753368-127753390 TGAGTGGGCAAGGCTGGGGCAGG + Intronic
1060976106 9:127766164-127766186 AAAGAGGGCCAGGGTGGGGCAGG - Intronic
1060993160 9:127860531-127860553 TGAGATGGAAAGACTGAGGCAGG - Intergenic
1061043262 9:128151508-128151530 TGAGCTGTCACGGGTTGGGCCGG + Intronic
1061418763 9:130462084-130462106 TGGGTGGGCAGGGGTGGGGCTGG - Intronic
1061718538 9:132537104-132537126 TGAGGAGCCAAGGGAGGGGCGGG + Intronic
1061801391 9:133115137-133115159 GGAGATGGCAGGGCTGGGGCAGG - Intronic
1061865896 9:133491624-133491646 GGATAAGGCAAGGGTGGGGCTGG + Intergenic
1062205023 9:135331483-135331505 AGAAATGGCCAGGGCGGGGCAGG + Intergenic
1062255238 9:135617717-135617739 AGAGGAGGCAAGGTTGGGGCCGG + Intergenic
1062380960 9:136286269-136286291 TGGGGTGGCAAGCGTGGGGGTGG + Exonic
1062396382 9:136354541-136354563 TGAGATGGACAGGCTGGGGCCGG + Intronic
1186918347 X:14248083-14248105 TCAGATGGTAAGCGTGGGCCAGG + Intergenic
1187677158 X:21727716-21727738 GCAGATGGCAAGGGGGTGGCTGG - Intronic
1188835395 X:34948382-34948404 GGTGCTGGCAGGGGTGGGGCTGG - Intergenic
1189145484 X:38650909-38650931 TGAGATGGGAGAGGTTGGGCAGG - Intronic
1189508667 X:41638757-41638779 AGAGATGACAAGGCTGGGGTAGG + Intronic
1189558115 X:42166046-42166068 TGTGCTGGTAGGGGTGGGGCTGG + Intergenic
1190023887 X:46904223-46904245 TGACATGGCAACAGTGGGGAGGG - Intergenic
1190326597 X:49210523-49210545 TCACATGGCAAGGGTGGGAAGGG - Intronic
1190860050 X:54336323-54336345 GGGGATGGGGAGGGTGGGGCAGG - Intronic
1192089571 X:68139602-68139624 TGGGATGGCAATGGGGTGGCTGG + Intronic
1192546652 X:72019774-72019796 TGAGAAGGAAAGGATAGGGCTGG + Intergenic
1192569259 X:72189354-72189376 TAAGAGGGCAGAGGTGGGGCAGG - Intronic
1195292388 X:103441753-103441775 TGTGATGGGAAGGGTGGCACTGG - Intergenic
1195659110 X:107360999-107361021 CTGGATGGCAAGGGTGGGGAGGG - Intergenic
1196802933 X:119559750-119559772 TCAAATGGCAATGGAGGGGCCGG + Intronic
1196862771 X:120043185-120043207 TGAGATGGCATGGAGGGGTCAGG - Intergenic
1196880331 X:120193159-120193181 TGAGATGGCATGGAGGGGTCAGG + Intergenic
1197771415 X:130092000-130092022 GCAGACGGGAAGGGTGGGGCAGG - Intronic
1197838223 X:130718021-130718043 GGAGAGGGAAACGGTGGGGCAGG - Intronic
1198079450 X:133225399-133225421 TGAGGTGGGAAGGGTGGGTGTGG + Intergenic
1199603007 X:149554094-149554116 TCAGATGGAAAGGGAGGGGAGGG + Intergenic
1199647381 X:149925381-149925403 TCAGATGGAAAGGGAGGGGAGGG - Intergenic
1199737419 X:150696762-150696784 TAAGATGGTAGGGGTGGGGTGGG + Intronic
1199872546 X:151912531-151912553 TGAGGAGGCAAGGTGGGGGCAGG + Intronic
1200068276 X:153515374-153515396 TGGGAGGGCAGGTGTGGGGCTGG - Intergenic
1200110008 X:153736266-153736288 AAGGATGGCAAGGGTGGGGCTGG - Intronic
1200212293 X:154352124-154352146 TGCGTTGGCCAGGGTGGGGTTGG - Intronic
1201354455 Y:13082706-13082728 CATGATGGGAAGGGTGGGGCAGG - Intergenic
1202369372 Y:24186707-24186729 TGAGAAGGCCAGGGTGTTGCGGG + Intergenic
1202501413 Y:25483410-25483432 TGAGAAGGCCAGGGTGTTGCGGG - Intergenic